|
|
||||||||
Cambridge University Department of Pathology, Tennis Court Road, Cambridge CB2 1QP, UK
Correspondence
Graham P. Stafford
gps25{at}cam.ac.uk
| ABSTRACT |
|---|
|
|
|---|
flhE mutant by the 130 aa putative envelope protein FlhE, but not by a truncated version lacking the N-terminal signal peptidase I recognition sequence. The
flhE mutant was indistinguishable from the wild-type parent in number and distribution of flagella, secretion of flagellin subunits, and flagellar gene expression, and there were no obvious differences in cell-surface LPS and extracellular polysaccharide. The
flhE mutant was able to swarm when non-ionic surfactant was included in agar medium, and it showed differences to the wild-type in binding calcofluor and Congo red dyes, and in biofilm production. The data show that the flhE gene is part of the flagella regulon but that it has no role in flagella biogenesis. It appears, nevertheless, to act at the cell envelope to influence flagella-dependent swarming.
| INTRODUCTION |
|---|
|
|
|---|
28) that activates late genes encoding the multicomponent flagellar filament, motor and chemotaxis apparatus (Chadsey et al., 1998
Motility genes are clustered within three loci around the chromosome of Sal. typhimurium and related bacteria (Macnab, 1996
), and their approximate function has, in virtually all cases, been established. In this paper, we re-examine the gene flhE. This gene was given a flagellar nomenclature due to its location at the end of a large flagellar and chemotaxis gene locus, but an early report has indicated that it is not involved in motility (Minamino et al., 1994
).
| METHODS |
|---|
|
|
|---|
flhE strain, using primers
flhEFor (TCCGATAACCGTCATATCCGCATGCACGGCGACCATTGGAGGAAAATAATGGTGTAGGCTGGAGCTGCTTC) and
flhERev (TCCGGCAACCTACCTCACTTTATAAAACAGCGTTTCTATTTATTCAAATTCCGGGGATCCGTCGACC), and the pKD4 (KmR) plasmid as a template (Datsenko & Wanner, 2000
N (lacking aa 116) was cloned into pBAD18 after PCR using primers FlhE-T (AATTCTAGAAATAATTTTGTTAACTTTAAGAAGATATACCATGGGCGAAGGCGCGTGGCAG) and FlhERev to make pBAD18-FlhE
N.
Fluorescence microscopy of cells.
Cells scraped from swarm plates were resuspended in saline (to an OD600 of 0.05), and fixed onto glass slides using 4 % paraformaldehyde (in 20 mM PIPES, pH 7.4) before blocking with PBS (50 mM NaPO4/Na2PO4, pH 7.4, 150 mM NaCl) plus 3 % (w/v) BSA for 1 h at 25 °C. Primary anti-flagellin antibody (1/1000, v/v, in PBS) was added for 2 h before washing (2x10 min, PBS), incubation with AlexaFluor-488/594-conjugated anti-rabbit secondary antibody (1/1000, v/v, in PBS; Molecular Probes) (2 h, 25 °C), and further washing (3x10 min, PBS). Cell membranes were stained for 10 min with SynaptoRed (in the dark), and coverslips were mounted using ProLong Anti-fade reagent (Molecular Probes), and visualized using a fluorescence microscope (Leica DM IRBE). Images were captured by a CCD digital camera (Hamamatsu) and processed using OpenLab software (Improvision).
Cell fractionation.
Harvested swarm cells were resuspended in PBS, and diluted to an OD600 of 1.0. Total extracellular FliC protein was prepared by shearing (5 min vortex) of harvested cells, and TCA precipitation (10 %, v/v, final concentration) of cell-free supernatant at 4 °C for 1 h. Extracellular protein was centrifuged for 1 h at 300 000 g to separate filament (pellet) from monomeric flagellin (soluble fraction, precipitated with 10 % TCA, 4 °C, 1 h). Cells were separated into cytosolic and membrane fractions according to Auvray et al. (2001)
.
LPS and EPS extraction.
Crude LPS was prepared from swarm cells (number of cells equivalent to 1 ml culture at an OD600 of 1), according to Hitchcock & Brown (1983)
. LPS was also extracted by a hot-phenol method for analysis by urea (high molecular mass) and deoxycholate-SDS (low molecular mass) PAGE, and visualized using silver staining (Guard-Petter et al., 1995
). EPS was isolated and visualized according to Gygi et al. (1995)
.
Biofilm assay.
Overnight cultures grown in biofilm LB (10 g tryptone l1, 5 g yeast extract l1) were inoculated at a 1 in 10 dilution into 96-well PVC microtitre plate wells (Falcon) containing fresh biofilm LB plus 0.52 % glucose, and incubated overnight at 30 °C. Biofilm was washed twice with distilled water, air-dried for 30 min, and stained for 15 min with 1 % crystal violet before washing with water and air drying. Biofilm was quantified as absorbance at 550 nm, following extraction with 95 % ethanol (Mireles et al., 2001
).
In vivo assay of transcription.
Transcription was assessed as cell
-galactosidase activity (Miller, 1972
) of gene fusions created by EcoRI/BamHI cloning of flhB (using primers FlhBPromEco, GAATTCACACGAGACTTTCTTTATC; and FlhBPromBam, GGATCCGCAAACCCTGGATAG) and fliC (primers FliCpromEco, GAATTCTTTTGCAAAAATAATGC; and FliCpromBam, GGATCCTCAATTACAACTTGATG) promoter fragments into the lacZ fusion vector pGPS123 (Stafford et al., 2005
), which is identical to pRS551 except that KmR is replaced by GmR (Simons et al., 1987
). For RT-PCR, RNA was extracted from swarm cells using hot acidic phenol. After removal of contaminating DNA by using Rq1 DNase (Promega), cDNA specific for the flhB and flhE genes was synthesized using Mu-MLV reverse transcriptase (Promega), and primers flhBRevRT (TTCGGCGTGGCGATATAATG) and flhERevRT (ATTGCTCCGCACTTTTAACG), resulting in cDNA originating within flhB and flhE, respectively. In the final step, primers flhBRevRT/flhBForRT (internal to flhB, ACCGCTCATCGCGGGCGTGG) and flhERevRT/flhEForRT (flhE internal, TGGCGTTGTTGCTCTTTCC) were used to amplify internal fragments of flhB and flhE. To assess transcripts spanning the flhBA and flhAE intergenic regions, primer pairs flhBForRT/flhARevRT (TCGCGAAGTTACCGCCGACCAGG) and flhAForRT (TCCGATAACCGTCATATCC)/flhERTRev were used. All PCR reactions used Taq polymerase, and products were analysed on 1.5 % agarose ethidium bromide (EtBr) gels.
| RESULTS AND DISCUSSION |
|---|
|
|
|---|
28. The flhE gene is thus always linked to flagella genes, and has not been located separately from flagellar gene loci. The sequence identity between the deduced amino acid sequence of Sal. typhimurium FlhE, and those of other Enterobacteriaceae, ranges from 37 to 83 %, while it is lower (2838 %) for A. vinelandii, R. metallidurans and Chr. salexigens. All the flhE genes are 400±25 bp and encode proteins of approximately 14 kDa, with a predicted N-terminal signal peptidase I leader sequence, and a predicted periplasmic or outer membrane location; the FlhE sequences of the 10 genera in Fig. 1
|
|
|
flhE mutant, plasmid-borne transcriptional lacZ fusions were constructed to the flagellar class II promoter controlling the FlhD2C2-dependent flhBAE operon, and to the flagellar class III (
28-dependent) fliC promoter. The activity of these promoter fusions during growth in liquid culture revealed that while transcription of the class II flhB(AE) and class III fliC promoters was reduced 122- and 421-fold, respectively, in an flhDC mutant compared with the wild-type (Fig. 4a
flhE strain.
|
flhE strain, and compared with the wild-type (Fig. 4b
flhE mutant was also unchanged (data not shown). It remained possible that the number or distribution of flagella on the cell surface was changed by the
flhE mutation, so we examined wild-type and
flhE mutant cells harvested from swarm agar, and fixed to glass slides. Fig. 4(c)
flhE mutation does not reduce flagella gene expression, assembly or stability, or differentiation into swarm cells. The attenuation of flagellar-dependent swarming must have a non-flagellar cause.
Altered surface and biofilm properties of the
flhE strain
Transposon mutations attenuating swarming motility of flagellated bacteria have been mapped to genes involved in the biosynthesis, not only of cell-free surfactants (Nakano et al., 1992
; Eberl et al., 1999
), but also of LPS (Toguchi et al., 2000
; Belas et al., 1995
) and EPS. Fig. 4(d)
shows that representative samples of crude LPS from the wild-type and
flhE strains, extracted according to Hitchcock & Brown (1983)
, failed to highlight any obvious differences. Furthermore, low-molecular-mass (Fig. 4d
) and high-molecular-mass LPS (data not shown) were analysed by silver staining (Guard-Petter et al., 1995
), and, again, no changes between the two strains were evident. In common with LPS, some components of the EPS are thought to reduce surface resistance, and aid in swarming migration; for example, a mutation in the cmfA gene of the strongly swarming Proteus mirabilis abolished swarming migration due to loss of an EPS rich in galacturonic acid and galactosamine (Gygi et al., 1995
). However, when crude acid hydrolysable EPS was assessed according to Gygi et al. (1995)
, again no differences were observed between the mutant and the wild-type (data not shown). This is unsurprising, since the biosynthetic pathways for LPS and several types of EPS are well characterized, and FlhE shares no motifs with their enzymes.
Such transposon mutations attenuating swarming motility commonly reduce the wettability of the bacterial cell surface (Toguchi et al., 2000
; Gygi et al., 1995
; Belas et al., 1995
; Lai et al., 2005
), and swarming by such mutants, and of the weakly swarming Esc. coli K-12, can be recovered by the addition of external surfactants such as Tween 80 (Niu et al., 2005
; Toguchi et al., 2000
). The Sal. typhimurium
flhE strain was incubated on 0.6 % agar plates containing the non-ionic detergent Tween 80 to increase wetting and reduce the surface tension of the agar. As shown in Fig. 5
(a), swarming was recovered to almost the wild-type level. However, this could not be restored by addition of spent medium from a wild-type culture, indicating that the swarming defect of the
flhE strain was not due to the absence of a secreted surfactant, such as serawettin from Ser. marcescens (Matsuyama et al., 1992
).
|
flhE mutant, and the
flhE mutant complemented with FlhE, on LB agar containing calcofluor, an LB agar containing Congo red and Coomassie blue, which have been used to highlight altered sugar composition (binding to
-glucans, particularly cellulose) and expression of thin aggregative filaments (curli) in the Sal. typhimurium extracellular matrix (Solano et al., 1998
flhE mutant colonies have altered colony morphology on both media, and that this phenotype reverted to wild-type when FlhE was provided in trans. Such changes in calcofluor-binding properties of colonies have been shown to correlate with mutations in the bcs operons responsible for biosynthesis of cellulose (Solano et al., 2002
flhE mutant colonies were still able to make biofilm under similar conditions (i.e. glass in adherence test medium) (data not shown), suggesting that the
flhE change in calcofluor binding was not due to alteration in cellulose production. Despite the Salmonella wild-type SJW1103 not displaying an rdar phenotype on Congo-red-containing medium, it did display a lacy edged colony morphology, while the
flhE colonies did not (Fig. 5b
The extracellular matrices of Salmonella and Esc. coli are also involved in biofilm formation on other inert surfaces, such as PVC and polystyrene (Mireles et al., 2001
; Römling et al., 1998
), and reduced swarming and increased adherence to PVC have been reported in a ddhC mutant (defective in O antigen synthesis) (Mireles et al., 2001
). We assessed biofilm formation by wild-type and
flhE strains growing on the PVC surface of microtitre wells. After crystal violet staining (Fig. 5b
), quantification according to Mireles et al. (2001)
confirmed the visual impression that the
flhE mutant formed approximately fivefold more biofilm than wild-type under all conditions tested (0.52 % glucose). Altered biofilm formation on PVC surfaces can also be associated with altered curli expression levels, but this is not the case for the
flhE strain, since assessment of curli levels using anti-CsgA antisera indicated unchanged curli expression (data not shown). Nonetheless, the extracellular matrix is complex, and new components continue to come to light (Wang et al., 2004
; Branda et al., 2005
).
Conclusion
The data suggest that flhE belongs to the flagellar regulon, but is not required for individual cell motility, or any aspect of flagellar production. The data suggest that it nevertheless has a role in the swarming motility of peritrichously flagellated Gram-negative bacteria, possibly influencing the composition of the extracellular matrix, and increasing surface lubrication or wettability. The protein sequences deduced from the flhE genes cited in Fig. 1
are short sequences of 138158 aa that have no significant similarity with any protein in the current sequence databases. All FlhE proteins have a putative signal peptidase I leader sequence, indicative of a periplasmic or outer-membrane location, and removal of this N-terminal sequence (aa 116) apparently results in a loss of function. FlhE proteins have 713 proline residues, and proline-rich regions are often involved in proteinprotein interactions (Seifert et al., 2004
; Larsen et al., 1993
). The flhE gene is not associated in the genome with other unknown genes, suggesting that it is not part of a pathway, but rather that it may encode a structural protein that acts alone on the surface, or contributes to a matrix-specific biofilm; for example, a protein that influences interaction with other cells in raft formation, or lubrication for surface movement. These possibilities are as yet unsupported by data, and it remains to be seen what this motility protein does.
| ACKNOWLEDGEMENTS |
|---|
Edited by: S. C. Andrews
| REFERENCES |
|---|
|
|
|---|
Allison, C., Emody, L., Coleman, N. & Hughes, C. (1994). The role of swarm cell differentiation and multicellular migration in the uropathogenicity of Proteus mirabilis. J Infect Dis 169, 11551158.[Medline]
Altschul, S. F., Madden, T. L., Schäffer, A. A., Zhang, J., Zhang, Z., Miller, W. & Lipman, D. J. (1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25, 33893402.
Auvray, F., Thomas, J., Fraser, G. M. & Hughes, C. (2001). Flagellin polymerisation control by a cytosolic export chaperone. J Mol Biol 308, 221229.[CrossRef][Medline]
Belas, R., Goldman, M. & Ashliman, K. (1995). Genetic analysis of Proteus mirabilis mutants defective in swarmer cell elongation. J Bacteriol 177, 823828.
Branda, S. S., Vik, S. Friedman L. & Kolter, R. (2005). Biofilms: the matrix revisited. Trends Microbiol 13, 2026.[CrossRef][Medline]
Chadsey, M. S., Karlinsey, J. E. & Hughes, K. T. (1998). The flagellar anti-sigma factor FlgM actively dissociates Salmonella typhimurium sigma28 RNA polymerase holoenzyme. Genes Dev 12, 31233136.
Chaudhuri, R. R., Khan, A. M. & Pallen, M. J. (2004). coliBASE: an online database for Escherichia coli, Shigella and Salmonella comparative genomics. Nucleic Acids Res 32, 296299.
Datsenko, K. A. & Wanner, B. L. (2000). One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A 97, 66406645.
Dufour, A., Furness, R. B. & Hughes, C. (1998). Novel genes that upregulate the Proteus mirabilis flhDC master operon controlling flagellar biogenesis and swarming. Mol Microbiol 29, 741751.[CrossRef][Medline]
Eberl, L., Soren-Molin, I. & Givskov, M. (1999). Surface motility of Serratia liquefaciens MG1. J Bacteriol 181, 17031712.
Fraser, G. M. & Hughes, C. (1999). Swarming motility. Curr Opin Microbiol 2, 630635.[CrossRef][Medline]
Givskov, M., Eberl, L., Christiansen, G., Benedik, M. J. & Molin, S. (1995). Induction of phospholipase and flagellar synthesis in Serratia liquefaciens is controlled by expression of the flagellar master operon flhD. Mol Microbiol 15, 445454.[Medline]
Guard-Petter, J. (2001). The chicken, the egg and Salmonella enteritidis. Environ Microbiol 3, 421430.[CrossRef][Medline]
Guard-Petter, J., Lakshmi, B., Carlson, R. & Ingram, K. (1995). Characterization of lipopolysaccharide heterogeneity in Salmonella enteritidis by an improved gel electrophoresis method. Appl Environ Microbiol 61, 28452851.
Gygi, D., Rahman, M. M., Lai, H. C., Carlson, R., Guard-Petter, J. & Hughes, C. (1995). A cell-surface polysaccharide that facilitates rapid population migration by differentiated swarm cells of Proteus mirabilis. Mol Microbiol 17, 11671175.[CrossRef][Medline]
Hay, N. A., Tipper, D. J., Gygi, D. & Hughes, C. (1997). A nonswarming mutant of Proteus mirabilis lacks the Lrp global transcriptional regulator. J Bacteriol 179, 47414746.
Hay, N. A., Tipper, D. J., Gygi, D. & Hughes, C. (1999). A novel membrane protein influencing cell shape and multicellular swarming of Proteus mirabilis. J Bacteriol 181, 20082016.
Hitchcock, P. J. & Brown, T. M. (1983). Morphological heterogeneity among Salmonella lipopolysaccharide chemotypes in silver-stained polyacrylamide gels. J Bacteriol 154, 269277.
Karlinsey, J. E., Tanaka, S., Bettenworth, V., Yamaguchi, S., Boos, W., Aizawa, S. I. & Hughes, K. T. (2000). Completion of the hookbasal body complex of the Salmonella typhimurium flagellum is coupled to FlgM secretion and fliC transcription. Mol Microbiol 37, 12201231.[CrossRef][Medline]
Kutsukake, K., Ohya, Y. & Iino, T. (1990). Transcriptional analysis of the flagellar regulon of Salmonella typhimurium. J Bacteriol 172, 741747.
Lai, H. C., Soo, P. C., Wei, J. R., Yi, W. C., Liaw, S. J., Horng, Y. T., Lin, S. M., Ho, S. W., Swift, S. & Williams, P. (2005). The RssAB two-component signal transduction system in Serratia marcescens regulates swarming motility and cell envelope architecture in response to exogenous saturated fatty acids. J Bacteriol 187, 34073414.
Larsen, R. A., Wood, G. E. & Postle, K. (1993). The conserved proline-rich motif is not essential for energy transduction by Escherichia coli TonB protein. Mol Microbiol 10, 943953.[CrossRef][Medline]
Macnab, R. M. (1996). Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology, pp. 123-145. Edited by F. C. Neidhardt and others. Washington, DC: American Society for Microbiology.
Matsuyama, T., Kaneda, K., Nakagawa, Y., Isa, K., Hara-Hotta, H. & Yano, I. (1992). A novel extracellular cyclic lipopeptide which promotes flagellum-dependent and -independent spreading growth of Serratia marcescens. J Bacteriol 174, 17691776.
McCarter, L. L. (2001). Polar flagellar motility of the Vibrionaceae. Microbiol Mol Biol Rev 65, 445462.
Miller, J. H. (1972). Experiments in Molecular Genetics. Cold Spring Harbour, NY: Cold Spring Harbor Laboratory.
Minamino, T., Iino, T. & Kutuskake, K. (1994). Molecular characterization of the Salmonella typhimurium flhB operon and its protein products. J Bacteriol 176, 76307637.
Mireles, J. R. II, Toguchi A. & Harshey, R. M. (2001). Salmonella enterica serovar typhimurium swarming mutants with altered biofilm-forming abilities: surfactin inhibits biofilm formation. J Bacteriol 183, 58485854.
Nakano, M. M., Corbell, N., Besson, J. & Zuber, P. (1992). Isolation and characterization of sfp: a gene that functions in the production of the lipopeptide biosurfactant, surfactin, in Bacillus subtilis. Mol Gen Genet 232, 313321.[Medline]
Niu, C., Graves, J. D., Mokuolu, F. O., Gilbert, S. E. & Gilbert, E. S. (2005). Enhanced swarming of bacteria on agar plates containing the surfactant Tween 80. J Microbiol Methods 62, 129132.[CrossRef][Medline]
Ohnishi, K., Ohto, Y., Aizawa, S., Macnab, R. M. & Iino, T. (1994). FlgD is a scaffolding protein needed for flagellar hook assembly in Salmonella typhimurium. J Bacteriol 176, 22722281.
Römling, U., Bian, Z., Hammar, M., Sierralta, W. D. & Normark, S. (1998). Curli fibers are highly conserved between Salmonella typhimurium and Escherichia coli with respect to operon structure and regulation. J Bacteriol 180, 722731.
Seifert, T. B., Bleiweis, A. S. & Brady, L. J. (2004). Contribution of the alanine-rich region of Streptococcus mutans P1 to antigenicity, surface expression, and interaction with the proline-rich repeat domain. Infect Immun 72, 46994706.
Simons, R. W., Houman, F. & Kleckner, N. (1987). Improved single and multicopy lac-based cloning vectors for protein and operon fusions. Gene 53, 8596.[CrossRef][Medline]
Solano, C., Sesma, B., Alvarez, M., Humphrey, T. J., Thorns, C. J. & Gamazo, C. (1998). Discrimination of strains of Salmonella enteritidis with differing levels of virulence by an in vitro glass adherence test. J Clin Microbiol 36, 674678.
Solano, C., Garcia, B., Valle, J., Berasain, C., Ghigo, J. M., Gamazo, C. & Lasa, I. (2002). Genetic analysis of Salmonella enteritidis biofilm formation: critical role of cellulose. Mol Microbiol 43, 793808.[CrossRef][Medline]
Soutourina, O. A. & Bertin, P. N. (2003). Regulation cascade of flagellar expression in Gram-negative bacteria. FEMS Microbiol Rev 27, 505523.[CrossRef][Medline]
Stafford, G. P., Ogi, T. & Hughes, C. (2005). Binding and transcriptional activation of non-flagellar genes by the Escherichia coli flagellar master regulator FlhD2C2. Microbiology 151, 17791788.
Toguchi, A., Siano, M., Burkart, M. & Harshey, R. M. (2000). Genetics of swarming motility in Salmonella enterica serovar typhimurium, critical role for lipopolysaccharide. J Bacteriol 182, 63086321.
Wang, Q., Frye, J. G., McClelland, M. & Harshey, R. M. (2004). Gene expression patterns during swarming in Salmonella typhimurium, genes specific to surface growth and putative new motility and pathogenicity genes. Mol Microbiol 52, 169187.[CrossRef][Medline]
Wang, X., Preston, J. F., III & Romeo, T. (2004). The pgaABCD locus of Escherichia coli promotes the synthesis of a polysaccharide adhesin required for biofilm formation. J Bacteriol 186, 27242734.
Yamaguchi, S., Fujita, H., Taira, T., Kutsukake, K., Homma, M. & Iino, T. (1984). Genetic analysis of three additional fla genes in Salmonella typhimurium. J Gen Microbiol 130, 33393342.
Received 18 September 2006;
revised 9 November 2006;
accepted 10 November 2006.
This article has been cited by other articles:
![]() |
T. Hirano, S. Mizuno, S.-I. Aizawa, and K. T. Hughes Mutations in Flk, FlgG, FlhA, and FlhE That Affect the Flagellar Type III Secretion Specificity Switch in Salmonella enterica J. Bacteriol., June 15, 2009; 191(12): 3938 - 3949. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. T. E. Niba, Y. Naka, M. Nagase, H. Mori, and M. Kitakawa A Genome-wide Approach to Identify the Genes Involved in Biofilm Formation in E. coli DNA Res, January 7, 2008; (2008) dsm024v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. G. Chen, L. Turner, and H. C. Berg The Wetting Agent Required for Swarming in Salmonella enterica Serovar Typhimurium Is Not a Surfactant J. Bacteriol., December 1, 2007; 189(23): 8750 - 8753. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |