|
|
||||||||
Institute of Biochemistry and Molecular Biology, School of Life Science, National Yang-Ming University, Taipei, Taiwan
Correspondence
Gwo-Chyuan Shaw
gcshaw{at}ym.edu.tw
| ABSTRACT |
|---|
|
|
|---|
A-like promoter sequence preceding kduI. Gel mobility shift assays and DNase I footprinting analyses indicated that KdgR is capable of binding specifically to two sites within the kdgRkduI intergenic region in vitro. Reporter gene analysis revealed that these two KdgR-binding sites function in vivo. One site is centred 33.5 bp upstream of the translational start site of kdgR and can serve as an operator for controlling expression of the kdgRKAT operon. The other is centred 57.5 bp upstream of the translational start site of kduI and can serve as an operator for controlling expression of the kduID operon. Possible physiological significance of this regulation is discussed.
| INTRODUCTION |
|---|
|
|
|---|
|
Bacillus subtilis is a soil bacterium that has easy access to galacturonate as well as its metabolic precursors and derivatives present in the soil. A genetic locus that is essential for growth of B. subtilis on galacturonate as a carbon source has been identified (Mekjian et al., 1999
). This locus contains the uxaA, uxaB and uxaC genes, which encode enzymes responsible for degradation of galacturonate into KDG (Fig. 1
). Expression of these genes, including exuT, is negatively regulated by the ExuR repressor encoded by the same locus (Mekjian et al., 1999
). The operator for the ExuR repressor is a 26 bp perfect inverted repeat (TCAAAATGTTAACGTTAACATTTTGA) located between the exuP1 promoter and the uxaC gene. Another locus that contains two divergently transcribed operons, kdgRKAT and kduID, was also identified by homology with Er. chrysanthemi genes. These operons encode enzymes for conversion of DKI into KDG and KDG into pyruvate plus glyceraldehyde 3-phosphate (Pujic et al., 1998
) (Fig. 1
). It was demonstrated that the kdgRKAT operon of B. subtilis is negatively regulated by the KdgR repressor encoded by the first gene of the kdgRKAT operon. Expression of the kdgRKAT operon can be induced by galacturonate and repressed by glucose (Pujic et al., 1998
). Amino acid sequence comparison revealed no significant similarity between the KdgR repressors of B. subtilis and Er. chrysanthemi. The operator for the B. subtilis KdgR repressor has not been identified yet. In this report, we present evidence that the KdgR repressor can also negatively regulate expression of the kduID operon. We show that expression of the kduID operon can be induced by galacturonate and is subject to catabolite repression by glucose. We have identified two KdgR-binding sites within the kdgRkduI intergenic region, which serve as operators for controlling expression of the kdgRKAT and kduID operons, respectively.
| METHODS |
|---|
|
|
|---|
|
To construct plasmid pGS1436, which can overproduce a maltose-binding protein (MalE)-KdgR fusion protein, a 1.06 kb DNA fragment carrying the coding sequence of kdgR and flanked by BamHI and HindIII sites was cloned between the BamHI and HindIII sites of pMAL-c2 (New England Biolabs).
To construct a plasmid that overproduces KdgR in B. subtilis, a 1.08 kb DNA fragment carrying the ShineDalgarno sequence plus the kdgR gene and flanked by EcoRI and HindIII sites was amplified by PCR and cloned between the EcoRI and HindIII sites of pHY300PLK (Takara Shuzo Co.) to generate plasmid pGS1513. The promoter of the tetracycline resistance gene present in pHY300PLK can thus drive the expression of kdgR in B. subtilis.
To construct plasmid pGS1454, a 0.49 kb DNA fragment that contains the promoter region plus the N-terminal coding region of kduI and is flanked by BamHI and HindIII sites was amplified by PCR and cloned between the BamHI and HindIII sites of pLC4 (Ray et al., 1985
). Various DNA fragments flanked by SalI and HindIII sites in plasmids pGS1574, pGS1575, pGS1560 and pGS1561 as shown in Fig. 7
were amplified by PCR and cloned individually between the SalI and HindIII sites of the promoter probe vector pUBCAT (Wen et al., 1989
).
|
Primer extension and Northern analyses.
Total RNA was prepared by the previously described method (Zuber & Losick, 1983
). The kduI transcriptional start site was determined by the previously described method of primer extension (Inoue & Cech, 1985
) using synthetic oligonucleotide 5'-TTGTTCAGGATGTACAGAA-3'. Northern analysis was carried out as described by Ausubel et al. (1994)
.
Overproduction and purification of the MalE-KdgR fusion protein.
E. coli JM109 cells bearing plasmid pGS1436 were grown in LB medium. After the OD600 had reached 0.5, IPTG was added at a final concentration of 0.3 mM and incubation was continued for 2 h. After harvesting cells by centrifugation and disrupting resuspended cells by sonication on ice, the disrupted cells were subjected to centrifugation at 15 000 g for 10 min. Purification of the MalE-KdgR fusion protein on an amylose column was carried out according to the instructions of the matrix manufacturer (New England Biolabs). In order to cleave the MalE from KdgR, 100 µg MalE-KdgR was incubated with 1 µg factor Xa protease (New England Biolabs) at 4 °C for 2 days. The progress of cleavage was checked by SDS-13 % PAGE. The released KdgR protein was used without further purification.
Gel mobility shift assays.
Gel mobility shift assays to determine binding of KdgR to DNA were carried out as described by Fried & Crothers (1981)
with slight modification (Lee et al., 2001
). For determination of the apparent dissociation constant (Kd), 32P-labelled DNA fragments at a concentration of 100 pM were titrated with various concentrations of KdgR. The KdgR protein was assumed to be a dimer in solution. Binding solutions were subjected to nondenaturing 8 % PAGE, and bands were visualized by using a Molecular Dynamics PhosphorImager. The phosphorimage was analysed with ImageQuant software.
Other methods.
Transformation of B. subtilis cells by the protoplast method was carried out as described by Chang & Cohen (1979)
. DNase I footprinting analysis was performed exactly as previously described (Chiou et al., 2002
). An established method was used for spectrophotometric measurement of CAT activity (Shaw, 1975
). Protein concentrations were determined by the BCA protein assay method according to the instructions of the manufacturer (Pierce Biotechnology) with bovine serum albumin as the standard.
| RESULTS AND DISCUSSION |
|---|
|
|
|---|
|
|
Involvement of the ccpA gene in catabolite repression of the kduID operon
Northern analysis was also carried out to test whether expression of the kduID operon is subject to catabolite repression by glucose. As shown in Fig. 4
, 0.5 % galacturonate could induce expression of the kduID operon in the wild-type B. subtilis, but when cells were grown in the presence of 0.5 % galacturonate plus 2 % glucose, expression of the kduID operon was reduced to a very low level, suggesting catabolite repression of the kduID operon. Previous studies have shown that the CcpA protein is a major transcription factor mediating catabolite repression in B. subtilis (Stulke & Hillen, 2000
). To further test whether the ccpA gene is involved in glucose repression of kduID, a ccpA disruption mutant (BM1034) was constructed as described in Methods. Fig. 4
shows that inactivation of the ccpA gene abolished catabolite repression of the kduID operon, indicating the involvement of the ccpA gene. Moreover, the expression level of kduID in the ccpA mutant grown in the presence of galacturonate was considerably higher than that observed in the wild-type. In a control experiment, using the pgk-specific probe did not detect a significant difference in the level of control RNA between the wild-type and kdgR mutant grown in the presence of galacturonate (Fig. 4c
). A similar result was also observed with the kdgRKAT operon in the ccpA mutant grown in the presence of galacturonate (data not shown). The underlying mechanism remains to be explored.
|
A-like promoter sequence preceding kduI
A-like promoter sequence (Helmann, 1995
A-dependent promoter.
Binding of KdgR to the kduI promoter region in vitro
We then explored whether purified KdgR could bind to the kduI promoter region in vitro. To facilitate purification, we constructed plasmid pGS1436, which could overproduce a maltose-binding protein (MalE)-KdgR fusion protein. This MalE-KdgR fusion protein was purified from the crude extract of E. coli cells carrying pGS1436 by affinity chromatography on an amylose column. The KdgR protein released from cleavage of purified MalE-KdgR fusion protein with factor Xa protease was used without further purification. Gel mobility shift assays showed that the KdgR protein could bind to a 0.19 kb DNA fragment containing the kduI promoter region, but not to a 0.2 kb control DNA fragment containing the bscR promoter region (Lee et al., 2001
) (Fig. 5a
). These results indicated that the KdgR repressor could bind directly and specifically to the kduI promoter region. The affinity of KdgR for the kduI promoter region was also assessed in a gel mobility shift assay. For determination of the half-maximal binding, decreases in band intensity of the free DNA probe as a function of KdgR concentrations were measured. The apparent dissociation constant (Kd) was estimated to be 0.62 nM.
|
|
Binding of KdgR to the kdgR promoter region in vitro
It is known that KdgR can negatively regulate expression of the kdgRKAT operon in B. subtilis, but the operator for this control has not been identified (Pujic et al., 1998
). Therefore, we attempted to use gel mobility shift assays to examine whether purified KdgR could also interact with the kdgR promoter region in vitro. As shown in Fig. 5(b)
, KdgR was capable of binding to the kdgR promoter region but not to the control DNA, suggesting that the binding is specific. The affinity of KdgR for the kdgR promoter region was determined in a similar way to that described for the kduI promoter. The apparent Kd was estimated to be 0.49 nM.
DNase I footprinting analysis was also used to determine the location of the binding site for KdgR in the kdgR promoter region. When the template strand of kdgR DNA was end-labelled with 32P, the addition of KdgR protein protected the sequences from +12 to +31 [relative to the transcriptional initiation site of kdgR (Pujic et al., 1998
)] from digestion by DNase I. This region is also a part of another 18 bp imperfect inverted repeat (from +9 to +26) (Figs 2a and 6c![]()
), whose nucleotide sequence is quite similar to that of the 18 bp inverted repeat present in the kduI promoter region (15 out of 18 nucleotides are identical). When the non-template strand of kdgR DNA was end-labelled with 32P, the KdgR protein was found to protect the segment from +8 to +28 (Figs 2a and 6d![]()
).
To further examine whether KdgR could interact specifically with the 18 bp inverted repeat, a double-stranded oligonucleotide containing the inverted repeat [Oligo(kdgR), wild-type] and a double-stranded oligonucleotide containing a 4 bp mutation in the 18 bp inverted repeat [Oligo(kdgR), mutant] (Fig. 5d
) were used as probes in gel mobility shift assays. The result showed that KdgR was capable of binding to the wild-type Oligo(kdgR) but not to the mutant Oligo(kdgR), suggesting that the wild-type inverted repeat is also a binding site for KdgR.
We also used gel mobility shift assays to test whether galacturonate could exert its inductive effects by dissociating the KdgRDNA complex directly. It was found that galacturonate at a concentration of up to 0.5 % (w/v) did not interfere with the formation of KdgRDNA complex in vitro (data not shown). This result suggests that galacturonate per se is not the actual inducer; its metabolic derivative(s) may be the authentic inducer. It has been demonstrated that in Er. chrysanthemi, KDG is the true inducer that causes dissociation of KdgR from its operator (Nasser et al., 1992
). It remains to be explored whether this is the case with B. subtiliis.
Effect of deletion of the KdgR-binding site in the kduI promoter region on expression of the kduI promoter-cat fusion in vivo
To examine effect of deletion of the KdgR binding site in the kduI promoter region on expression of the kduI promoter-cat transcriptional fusion in vivo, DNA fragments containing the kduI promoter region with or without the 18 bp inverted repeat were amplified by PCR and transcriptionally fused to a promoterless cat gene on the promoter probe vector pUBCAT (Wen et al., 1989
). The resulting plasmids, pGS1560 and pGS1561 (Fig. 7
), were individually introduced into B. subtilis cells and crude cell extracts were assayed for CAT activity. As shown in Table 2
, when the 18 bp inverted repeat was present on plasmid pGS1560, galacturonate could enhance expression of the kduI promoter-cat fusion, probably by removing the KdgR repressor from this site. Deletion of the 18 bp inverted repeat led to derepression of the kduI promoter-cat fusion, and galacturonate could not further enhance kduI promoter-cat expression. These results are consistent with the idea that the 18 bp inverted repeat in the kduI promoter region acts as a KdgR-binding site and contributes to the control of kduID expression in vivo. The aforementioned Northern analysis revealed that the level of kduID expression in the kdgR mutant BM1048 was about 1.3-fold higher in the presence of galacturonate than that in its absence. However, results from CAT activity assays showed that galacturonate did not further enhance expression of the kduI promoter-cat fusion after deletion of the KdgR-binding site. These two observations imply that other galacturonate-responsive element(s) or repressor-binding site(s) may exist outside the kduI promoter region we tested.
|
Concluding remarks
In this study we have provided evidence that the B. subtilis KdgR repressor can directly regulate expression of the kduID operon. We have also identified two KdgR-binding sites: one functions as an operator for controlling kduID expression and the other serves as an operator for controlling kdgRKAT expression. The centres of these two KdgR-binding sites are separated by 131 bp (about 12.5 turns of the DNA helix) (Fig. 2a
). Since these two KdgR-binding sites are on the opposite sides of the DNA helix, it is unlikely that binding of KdgR to them is cooperative. It is interesting to note that these two KdgR-binding sites also contain a 14 bp catabolite-responsive element (CRE)-like sequence (Fig. 2a
). The consensus sequence 5'-(T/A)GNAA(C/G)CGN(T/A)(T/A)NCA-3' for CRE has been proposed previously (Hueck et al., 1994
). Deletion of the CRE-like sequence in the kduI promoter region almost abolished glucose repression of the kduI promoter-cat fusion (Table 2
). This suggests that the CRE-like sequence in the kduI promoter region is involved in catabolite repression. However, deletion of the CRE-like sequence in the kdgR promoter region did not have a large effect on glucose repression of the kdgR promoter-cat fusion (Table 2
). This is not unprecedented since the binding site for the aforementioned ExuR repressor of B. subtilis in the uxaC promoter region also contains a CRE-like sequence. Mutations in the CRE-like sequence also did not have a large effect on catabolite repression of uxaC by glucose (Mekjian et al., 1999
).
It is not difficult to imagine why KdgR controls expression of the kdgRKAT operon. Both KdgK and KdgA proteins are required to metabolize the metabolic derivatives of galacturonate (Pujic et al., 1998
). When galacturonate is present, kdgK and kdgA are derepressed and more KdgK and KdgA proteins are synthesized to carry out their functions. On the other hand, the observation that KdgR also controls kduID expression raises an interesting question, since KduI and KduD proteins are known to be involved in metabolism of DKI and DKII, which are not metabolic derivatives of galacturonate (Pujic et al., 1998
). One possible explanation is as follows. When the kdgT gene is derepressed due to the presence of galacturonate, more DKI and DKII present in the environment can be transported into cells via the KdgT transporter (Condemine & Robert-Baudouy, 1987
; Hugouvieux-Cotte-Pattat et al., 1996
). Therefore, the kduID operon is derepressed in the presence of galacturonate and more KduI and KduD proteins are synthesized to metabolize DKI and DKII.
It is thus conceivable that when both kdgRKAT and kduID operons are subject to negative control by the KdgR repressor, galacturonate can induce expression of both operons to carry out their functions.
| ACKNOWLEDGEMENTS |
|---|
Edited by: J. M. van Dijl
| REFERENCES |
|---|
|
|
|---|
Chang, S. & Cohen, S. N. (1979). High frequency transformation of Bacillus subtilis protoplasts by plasmid DNA. Mol Gen Genet 168, 111115.[CrossRef][Medline]
Chatterjee, A. K., Thurn, K. K. & Tyrell, D. J. (1985). Isolation and characterization of Tn5 insertion mutants of Erwinia chrysanthemi that are deficient in polygalacturonate catabolic enzymes oligogalacturonate lyase and 3-deoxy-D-glycero-2,5-hexodiulosonate dehydrogenase. J Bacteriol 162, 708714.
Chiou, C. Y., Wang, H. H. & Shaw, G. C. (2002). Identification and characterization of the non-PTS fru locus of Bacillus megaterium ATCC 14581. Mol Genet Genomics 268, 240248.[CrossRef][Medline]
Condemine, G. & Robert-Baudouy, J. (1987). 2-keto-3-deoxygluconate transport system in Erwinia chrysanthemi. J Bacteriol 169, 19721978.
Dimitrova, D. S., Giacca, M., Demarchi, F., Biamonti, G., Riva, S. & Falaschi, A. (1996). In vivo protein-DNA interactions at human DNA replication origin. Proc Natl Acad Sci U S A 93, 14981503.
Fedhila, S., Msadek, T., Nel, P. & Lereclus, D. (2002). Distinct clpP genes control specific adaptive responses in Bacillus thuringiensis. J Bacteriol 184, 55545562.
Fried, M. & Crothers, D. M. (1981). Equilibria and kinetics of lac repressor-operator interactions by polyacrylamide gel electrophoresis. Nucleic Acids Res 9, 65056525.
Helmann, J. D. (1995). Compilation and analysis of Bacillus subtilis sigma A-dependent promoter sequences: evidence for extended contact between RNA polymerase and upstream promoter DNA. Nucleic Acids Res 23, 23512360.
Hueck, C. J. Hillen, W. & Saier, M. H., Jr (1994). Analysis of a cis-active sequence mediating catabolite repression in gram-positive bacteria. Res Microbiol 145, 503518.[Medline]
Hugouvieux-Cotte-Pattat, N. & Reverchon, S. (2001). Two transporters, TogT and TogMNAB, are responsible for oligogalacturonide uptake in Erwinia chrysanthemi 3937. Mol Microbiol 41, 11251132.[CrossRef][Medline]
Hugouvieux-Cotte-Pattat, N. & Robert-Baudouy, J. (1987). Hexuronate catabolism in Erwinia chrysanthemi. J Bacteriol 169, 12231231.
Hugouvieux-Cotte-Pattat, N. & Robert-Baudouy, J. (1989). Isolation of Erwinia chrysanthemi mutants altered in pectinolytic enzyme production. Mol Microbiol 3, 15871597.[CrossRef][Medline]
Hugouvieux-Cotte-Pattat, N., Condemine, G., Nasser, W. & Reverchon, S. (1996). Regulation of pectinolysis in Erwinia chrysanthemi. Annu Rev Microbiol 50, 213257.[CrossRef][Medline]
Hugouvieux-Cotte-Pattat, N., Blot, N. & Reverchon, S. (2001). Identification of TogMNAB, an ABC transporter which mediates the uptake of pectic oligomers in Erwinia chrysanthemi 3937. Mol Microbiol 41, 11131123.[CrossRef][Medline]
Inoue, T. & Cech, T. R. (1985). Secondary structure of the circular form of the Tetrahymena rRNA intervening sequence: a technique for RNA structure analysis using chemical probes and reverse transcriptase. Proc Natl Acad Sci U S A 82, 648652.
Lee, T. R., Hsu, H. P. & Shaw, G. C. (2001). Transcriptional regulation of the Bacillus subtilis bscR-CYP102A3 operon by the BscR repressor and differential induction of cytochrome CYP102A3 expression by oleic acid and palmitate. J Biochem 130, 569574.
Ludwig, H., Homuth, G., Schmalisch, M., Dyka, F. M., Hecker, M. & Stulke, J. (2001). Transcription of glycolytic genes and operons in Bacillus subtilis: evidence for the presence of multiple levels of control of the gapA operon. Mol Microbiol 41, 409422.[CrossRef][Medline]
Mekjian, K. R., Bryan, E. M., Beall, B. W. & Moran, C. P., Jr (1999). Regulation of hexuronate utilization in Bacillus subtilis. J Bacteriol 181, 426433.
Nasser, W., Reverchon, S. & Robert-Baudouy, J. (1992). Purification and functional characterization of the KdgR protein, a major repressor of pectinolysis genes of Erwinia chrysanthemi. Mol Microbiol 6, 257265.[CrossRef][Medline]
Nasser, W., Reverchon, S., Condemine, G. & Robert-Baudouy, J. (1994). Specific interactions of Erwinia chrysanthemi KdgR repressor with different operators of genes involved in pectinolysis. J Mol Biol 236, 427440.[CrossRef][Medline]
Pujic, P., Dervyn, R., Sorokin, A. & Ehrlich, S. D. (1998). The kdgRKAT operon of Bacillus subtilis: detection of the transcript and regulation by the kdgR and ccpA genes. Microbiology 144, 31113118.[Abstract]
Ray, C., Hay, R. E., Carter, H. L. & Moran, C. P., Jr (1985). Mutations that affect utilization of a promoter in stationary-phase Bacillus subtilis. J Bacteriol 163, 610614.
Rodionov, D. A., Mironov, A. A., Rakhmaninova, A. B. & Gelfand, M. S. (2000). Transcriptional regulation of transport and utilization systems for hexuronides, hexuronates and hexonates in gamma purple bacteria. Mol Microbiol 38, 673683.[CrossRef][Medline]
Rodionov, D. A., Gelfand, M. S. & Hugouvieux-Cotte-Pattat, N. (2004). Comparative genomics of the KdgR regulon in Erwinia chrysanthemi 3937 and other gamma-proteobacteria. Microbiology 150, 35713590.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
San Francisco, M. J. & Keenan, R. W. (1993). Uptake of galacturonic acid in Erwinia chrysanthemi EC16. J Bacteriol 175, 42634265.
Shaw, W. V. (1975). Chloramphenicol acetyltransferase from chloramphenicol-resistant bacteria. Methods Enzymol 43, 737755.[Medline]
Stolt, P. & Stoker, N. G. (1996). Protein-DNA interactions in the ori region of the Mycobacterium fortuitum plasmid pAL5000. J Bacteriol 178, 66936700.
Stulke, J. & Hillen, W. (2000). Regulation of carbon catabolism in Bacillus species. Annu Rev Microbiol 54, 849880.[CrossRef][Medline]
Wen, L. P., Ruettinger, R. T. & Fulco, A. J. (1989). Requirement for a 1-kilobase 5'-flanking sequence for barbiturate-inducible expression of the cytochrome P-450BM-3 gene in Bacillus megaterium. J Biol Chem 264, 1099611003.
Zuber, P. & Losick, R. (1983). Use of a lacZ fusion to study the role of the spoO genes of Bacillus subtilis in developmental regulation. Cell 35, 275283.[CrossRef][Medline]
Received 16 September 2006;
revised 5 December 2006;
accepted 6 December 2006.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |