|
|
||||||||

1 Laboratoire de Chimie de l'Eau et de l'Environnement, UMR 6008, Université de Poitiers, 40 Avenue du Recteur Pineau, 86022 Poitiers Cedex, France
2 Unité de Génomique des Microorganismes Pathogènes and CNRS URA 2171, Institut Pasteur, 28 Rue du Dr Roux, 75724 Paris, France
Correspondence
Yann Héchard
yann.hechard{at}univ-poitiers.fr
| ABSTRACT |
|---|
|
|
|---|
pvcA L. pneumophila mutant showed no changes in biofilm formation compared to the wild-type, suggesting that the pvcA product is not mandatory for biofilm formation. However, biofilm formation by L. pneumophila wild-type and a
pvcA strain was clearly inhibited in iron-rich conditions.
Present address: Institut National de Recherches Agronomiques, Laboratoire de Microbiologie, Centre de Recherche INRA de Clermont Ferrand Theix, 63122 Saint-Genes Champanelle, France.
The microarray results for these experiments are accessible on the website http://genoscript.pasteur.fr/ (see text for details).
Two supplementary tables showing genes with significant differences in expression in sessile and planktonic cells and the expression fold change of genes associated with iron homeostasis are available with the online version of this paper.
| INTRODUCTION |
|---|
|
|
|---|
Numerous disinfection methods directed against Legionella have been described in the literature (Kim et al., 2002
). Unfortunately, these treatments generally do not lead to a total eradication of the bacterium, and recolonization occurs as soon as the treatments are interrupted (Thomas et al., 2004
). Resistance of L. pneumophila to disinfection is due not only to its capacity to enter amoebae, where bacteria could be protected from biocides, but also to its association with biofilms (Abu Kwaik et al., 1998
; Thomas et al., 2004
; Saby et al., 2005
). However, only very little information regarding the physiological state and gene expression of L. pneumophila within biofilms is currently available. A better knowledge of the L. pneumophila sessile lifestyle may help to reduce the presence of L. pneumophila within biofilms and, consequently, decrease its spread in the environment.
The aim of our work was to design a model biofilm for L. pneumophila and to study gene expression of sessile and planktonic L. pneumophila cells, to learn about the changes occurring in L. pneumophila biofilm. Our results give new insights into L. pneumophila biofilm formation and point to several genes that may be important for biofilm formation and maintenance.
| METHODS |
|---|
|
|
|---|
Microtitre plate assays of biofilm formation.
L. pneumophila biofilm formation was monitored using polystyrene 96-well microtitre plates (Nunclon MicroWell Plates, Nunc). Three distinct procedures were used in this study. (1) Biofilm formation at different temperatures was assayed using cells grown on BCYE plates at 37 °C, 5 % CO2 for 3–4 days. Cells were resuspended in BYE at OD600 0.15 and then aliquoted (150 µl) into eight wells of a 96-well microtitre plate, which was incubated at 20, 37 or 42 °C until late stationary phase. Medium and non-adherent cells were then removed by aspiration and the wells were rinsed with BYE (200 µl). Cells that had adhered to the wells were stained with 200 µl 0.3 % crystal violet (CV) at room temperature for 15 min. Excess CV was then removed and the wells were washed three times with water (400 µl). Fixed CV was solubilized in 200 µl 100 % ethanol, 15 min at room temperature. Biofilm formation was estimated by measuring the A595 of each well using a microtitre plate reader (Sunrise, Tecan) and calculating the mean from the eight wells. (2) Assays for adhesion were performed using cells grown at 20 °C in BYE liquid cultures, harvested at different growth phases (48, 120 and 192 h of growth for exponential, stationary and late stationary phase, respectively) and resuspended in BYE at OD600 2.0. Cell suspensions were then aliquoted (150 µl) into eight wells of a 96-well microtitre plate, which was incubated at 20 °C for 6 h. Adhesion was estimated by CV staining of adherent cells, as described above. (3) Assays for biofilm growth were done in a similar way using cells grown in BYE at 20 °C until late stationary phase. After 6 h incubation at 20 °C, medium and non-adherent cells were removed and 150 µl BYE were added to the wells. Incubation was continued for 7–14 days. Where indicated, medium and non-adherent cells were removed and replaced by sterile BYE on day 7. After incubation, biofilm formation was quantified by CV staining, as described above.
Biofilm conditions for transcriptome analyses.
L. pneumophila Lens biofilms were grown at 20 °C in 75 cm2 cell culture treated flasks (BD-Falcon). BYE (30 ml) was inoculated at an initial OD600 of 0.15 with cells from a preculture grown in BYE at 20 °C. The flask was incubated at 20 °C until growth reached late stationary phase. The cell suspension was then removed from the flask and planktonic cells (termed inoculation cells) were recovered by centrifugation (2 min, 3000 g, 4 °C) and immediately stored at –80 °C. Cells that had adhered to the bottom of the flask were covered with 100 ml fresh BYE and the flask was incubated at 20 °C. To avoid cell sedimentation onto the adhered cells, the flask was placed vertically. After 7 days, the culture medium was replaced by sterile BYE and incubation was continued for 7 days. The culture medium containing planktonic cells was then removed and cells (termed suspension cells) were recovered by centrifugation (2 min, 3000 g, 4 °C) and immediately stored at –80 °C. The flask was rinsed twice with BYE, and 1 ml cold BYE was added to the flask. Cells that had adhered to the walls of the flask were detached using a sterile cell scraper and resuspended in cold BYE. The resulting cell suspension was removed and biofilm cells (termed sessile cells) were recovered by centrifugation (2 min, 3000 g, 4 °C) and immediately stored at –80 °C.
Microscopic analyses of L. pneumophila biofilm.
Two distinct procedures were used for microscopic analyses of L. pneumophila biofilms. For electron microscopy, biofilms grown in cell culture flasks were fixed with 2 % glutaraldehyde in phosphate buffer (0.1 M, pH 7.2) for 1 h. Fixed biofilms were scraped from the culture flasks and transferred onto polylysine-coated glass slides. Subsequent dehydration was performed stepwise using 50, 70, 90 and 100 % acetone in water, 50 % ethanol : 50 % acetone, 100 % ethanol, 50 % ethanol : 50 % trichlorotrifluoroethane and finally 100 % trichlorotrifluoroethane. The samples were coated with gold and examined using a SEM JEOL JSM 840 electron microscope. Analysis of biofilm formation at various iron concentrations was performed using phase-contrast microscopy. L. pneumophila Lens was diluted in BYE medium containing 0, 0.25 or 1.25 g l–1 iron pyrophosphate to approximately 106 c.f.u. ml–1. Then 6 ml of this dilution was used to fill a six-well microtitre plate (Nunclon Delta Surface), to which microscope glass cover slides (18 mm x 18 mm) had been previously added. Biofilms were allowed to form for 2 weeks at 20 °C. The medium was changed after 1 week. At the end of the incubation, medium and non-adherent cells were removed and cells that had adhered to the glass slides were stained with 0.3 % CV at room temperature for 15 min. Glass slides with biofilms on both sides were rinsed with water and cleaned on the bottom side with an alcohol swab. The biofilm attached to the top side was examined by phase-contrast microscopy.
Total RNA isolation, cDNA synthesis and labelling.
The FastProtein Blue kit was used with a Fast Prep apparatus (Q-biogene) in order to lyse cells. Total RNA was extracted as described by Milohanic et al. (2003)
. RNA was quantified by A260 and A280 and its integrity was confirmed on 1 % agarose gels. The total preparation was divided into 10 µg aliquots that were stored at –80 °C until use. Absence of genomic DNA contamination was assayed by PCR amplification using two primers complementary to the mip gene (mipF, AGCATTGGTGCCGATTTG; and mipR, TCTGTCCATCCAGGGATAAC). Total RNA (10 µg) was used for cDNA synthesis with the Atlas Powerscript Fluorescent labelling kit (BD-Bioscience) and pd(N)6 primers (Roche), according to the manufacturer's recommendations. Two distinct cDNA syntheses were made for each cell sample and obtained cDNA were pooled. One half was then labelled with Cy3 and the other with Cy5.
Array hybridization and data analysis.
Hybridizations were performed using 250 pmol Cy3- and Cy5-labelled cDNA following the manufacturer's recommendations (Corning) and using slides described by Brüggemann et al. (2006)
. The cDNA of each cell sample was compared to that of the two others using two distinct hybridizations on slides, including a dye-swap. In addition, a biological replicate was carried out giving a total of 12 slides for the overall experiment. Slides were scanned on a GenePix 4000A scanner (Axon Instruments). Laser power and/or photomultiplier tubes (PMT) were adjusted to balance the two channels. The resulting files were analysed using Genepix Pro 4.0 software. Spots were excluded from analysis in cases of high local background fluorescence, slide abnormalities, or weak intensity. Data normalization and differential analysis were conducted using the R software (Brüggemann et al., 2006
; http://www.R-project.org). A Loess normalization (Yang et al., 2002
) was performed on a slide-by-slide basis (BioConductor package marray; http://www.bioconductor.org/packages/bioc/html/marray.html). Differential analysis was carried out separately for each comparison between two cell samples, using the VM method [VarMixt package (Delmar et al., 2005
)], together with the Benjamini and Yekutieli (Reiner et al., 2003
) P-value adjustment method. Only genes with significant (P<0.05) fold changes in expression were taken into consideration. Empty and flagged spots were excluded, and only genes with no missing values were analysed.
Quantitative RT-PCR.
cDNA templates were obtained from 10 µg total RNA using pd(N)6 primer (Roche) and M-MLV, RNase H Minus, Point Mutant reverse transcriptase (Promega) according to the manufacturer's instructions. Quantitative RT-PCR was performed on a LightCycler (Roche) using the LightCycler FastStart DNA MasterPLUS SYBR Green I kit (Roche) according to the manufacturer's instructions. The 16S rRNA gene was used as a reference gene to normalize gene expression, using primers 16SF (ACCTGGCCTAATACTGAC) and 16SR (TACGGGACTTAACCCAAC). The level of gene expression was assessed by determining the cycle at which the amplification curve crossed the detection threshold. This is defined as the crossing point (Cp). The relative changes in gene expression were calculated as commonly described (Livak & Schmittgen, 2001
) by calculating the 2–
Cp, where
Cp=Cp target gene–Cp reference gene (16S) and 
Cp=
Cp sample 1–
Cp sample 2.
Mutant construction.
Electro-competent cells of L. pneumophila Lens were prepared as follows. A bacterial suspension (100 µl, OD600 2) was plated on BCYE and incubated for 24 h at 37 °C. The cells were harvested from the plate surface and suspended in 40 ml 10 % (v/v) glycerol at 4 °C. Bacteria were centrifuged (4000 g, 10 min) and washed twice in 20 ml and 10 ml 10 % glycerol. Finally, cells were resuspended in 10 % glycerol at OD600 100, divided into 50 µl aliquots and frozen at –80 °C. Competent cells were electroporated with the pJS5 plasmid (Allard et al., 2006
), which contains a fragment carrying the pvcA gene inactivated by the insertion of a kanamycin-resistance gene. The transformants were plated on BCYE with kanamycin and tested by PCR using the PVCA9 F and PVCB6-R primers described previously (Allard et al., 2006
). The resulting mutant strain was used to test its ability to form biofilm as described above.
| RESULTS |
|---|
|
|
|---|
|
Transcriptome analyses
Total RNA of the three different cell samples, namely sessile cells, suspension cells and inoculation cells was used for cDNA synthesis, labelling and subsequent hybridization to a DNA oligonucleotide array containing 3823 gene-specific oligonucleotides (Brüggemann et al., 2006
). These probes were designed to match every predicted ORF in the three sequenced L. pneumophila genomes, of strains Lens, Paris and Philadelphia (Cazalet et al. 2004
, Chien et al., 2004
). Gene expression changes in the three different cell samples were recorded in a two-way comparison, i.e. sessile cells vs inoculation cells, sessile cells vs suspension cells and suspension cells vs inoculation cells. The full results are accessible on the website http://genoscript.pasteur.fr/ (choose Public area, then Legionella). Taking a twofold difference in gene expression between sessile and inoculation cells as a threshold, over 15.5 % of the L. pneumophila genes (457 out of 2932 predicted) were altered in their expression (see Supplementary Table S1, available with the online version of this paper). In addition, 11.2 % of the L. pneumophila genes (329 out of 2932 predicted) showed at least a twofold change in expression in comparisons of sessile and suspension cells (Table S1). Together, these results clearly indicate major changes between the sessile and planktonic forms. However, it is highly unlikely that all these changes are associated with the sessile mode of life per se. In order to focus our analysis on biofilm-specific genes, we selected genes with at least a twofold altered expression in biofilm cells relative to both planktonic cell populations. This revealed a total of 69 genes (2.3 % of the genome), among which 52 were upregulated and 17 downregulated (Table 1
). Searching for gene clusters or genes involved in the same biological pathway highlighted several genes. Five gene clusters with induced expression were identified within this group: lpl0236–0237, whose predicted products are similar to pyoverdine synthesis proteins; lpl0628–0629, which includes a gene encoding a putative aminochorismate lyase; lpl2213–2214, which encodes phosphatase and pseudouridine synthase; lpl2271–2272, which encodes alkyl hydroperoxide reductases; and lpl2916–2917, which probably encodes ATP synthase subunits. Moreover, virulence-related genes such as lpl0820, encoding the global regulator CsrA and lpl0497, encoding IcmJ/DotN, which is part of the type IV secretion system of L. pneumophila, are also induced in sessile cells. Two other induced genes (lpl2576 and lpl2686) encode ribosomal proteins. Finally a gene cluster showing reduced expression in sessile cells was identified: lpl1059–1060 that encodes proteins similar to EnhC involved in the entry into host cells and a major facilitator protein. To learn about the global physiological state of sessile cells, genes previously identified as good markers for the transmissive and replicative phases of the L. pneumophila life cycle during growth in Acanthamoeba castellanii (Bruggemann et al., 2006
) (Table 2
) were examined for their expression fold change in the sessile cells as compared to the inoculation cells. Actually, inoculation cells constitute a bacterial population in the late stationary phase of growth, whose gene expression profile resembles that of transmissive L. pneumophila cells (Bruggemann et al., 2006
). Interestingly, sessile cells appeared more related to bacteria in the replicative phase since flagellar genes (flaA, fliA and fliS), genes of the type IV secretion system substrates and their homologues (ralF, sdeA, sdcA and sidC) and enhA, encoding the enhanced entry protein A, were downregulated in the sessile cells. Accordingly, the key regulator csrA, known to repress the expression of transmissive traits, was clearly induced (4.29-fold) in sessile cells as compared to inoculation cells. However, when the more heterogeneous planktonic population constituted by suspension cells was used as reference, the flagellar genes, sdeA and sdcA, as well as csrA, appeared to be upregulated in sessile cells (Table 2
).
|
|
|
Effect of iron availability on biofilm-regulated gene expression
In order to determine whether iron availability constitutes a signal regulating gene expression in sessile cells, expression of the seven genes, here identified as biofilm-regulated, was measured by quantitative RT-PCR after growth in BYE broth supplemented with different iron concentrations. The pvc genes were positively regulated by iron since their expression under iron-rich conditions was 6–10-fold induced, compared to conditions without iron (Fig. 2a
). However, expression of other biofilm-regulated genes did not appear to be significantly altered by iron availability. These results underline a likely involvement of pvc gene products in iron homeostasis but suggest that iron does not constitute the only signal triggering biofilm-regulated gene induction in sessile cells. Accordingly, iron-regulated genes in L. pneumophila such as fur, frgA, iraAB or lbtAB (Cianciotto, 2007
) did not appear significantly regulated in our microarray data, except feoA (see Supplementary Table S2, available with the online version of this paper). The latter is involved in a ferrous-uptake system (Robey & Cianciotto, 2002
), whose expression was 1.99-fold induced (P=0.003) in sessile cells as compared to suspension cells.
|
pvcA mutant and the wild-type strain was then compared in BYE supplemented with various iron concentrations. As estimated by our standard microtitre plate assay, high iron pyrophosphate concentration (1.25 vs 0.25 g l–1) was detrimental to biofilm formation by wild-type L. pneumophila Lens, with a 6.5-fold reduction in CV binding (data not shown). This result was confirmed by microscopic analysis of biofilms formed on glass slides at various iron concentrations (Fig. 2b
pvcA mutant did not appear significantly different from those of the wild-type strain whatever the conditions tested. The product of pvcA alone thus did not appear necessary for biofilm establishment by L. pneumophila Lens in standard BYE containing 0.25 g iron pyrophosphate l–1. In addition, disruption of pvcA did not modify biofilm formation under iron-rich conditions, suggesting that the deleterious effect of iron on biofilm formation is neither mediated nor counterbalanced by pvcA induction in sessile cells. | DISCUSSION |
|---|
|
|
|---|
Our study has revealed that biofilm formed by L. pneumophila is more consistent at 20 °C than at 37 or 42 °C. Piao et al. (2006)
also reported that the L. pneumophila biofilms with structural features typical of biofilms (i.e. pillar- and mushroom-like structures) formed at 25 °C remained more stably attached than filamentous, mycelial-mat-like biofilms formed at 37 and 42 °C. Also, Mampel et al. (2006)
reported that biofilm formation at 37 °C was 30 % lower than at 23 and 30 °C. Furthermore, we have shown that adhesion is highest for late stationary phase cells. This is expected, as L. pneumophila shows increased expression of the flagellum and of type IV pili, both of which have been described in other bacteria to be involved in adhesion (O'Toole & Kolter, 1998
; Pratt & Kolter, 1998
; Watnick & Kolter, 1999
), in stationary phase during low-temperature growth (Heuner et al., 1999
; Soderberg et al., 2004
). Because stationary phase mimics the transmissive phase in which bacteria are released from amoebae (Molofsky & Swanson, 2004
), our observations suggest that bacteria that exit host cells in natural low-temperature environments are in an optimal physiological state to adhere to biofilms.
We report here the first transcriptome analysis of L. pneumophila biofilm cells. It reveals that expression of 2.3 % (69 genes) out of the 2932 predicted genes was changed at least twofold in biofilm cells with respect to two distinct planktonic cell populations. This is consistent with two previous reports on Escherichia coli biofilms that stated that genes whose expression is regulated in the same way when biofilm cells are compared to both exponential and stationary phase cells represent about 1 % of the predicted E. coli genes (Schembri et al., 2003
; Beloin et al., 2004
). The global physiological state of sessile L. pneumophila cells was judged by comparing the gene expression pattern with those determined for transmissive- and replicative-phase L. pneumophila during growth in A. castellanii (Bruggemann et al., 2006
). Interestingly, the gene encoding the global regulator, CsrA, involved in repression of transmission and survival traits (Molofsky & Swanson, 2003
), was induced in sessile cells. In our study, sessile cells thus seem to more closely resemble replicative- than transmissive-phase bacteria, suggesting that biofilm constitutes a favourable environment for L. pneumophila. Surprisingly, the flagellar genes whose expression is induced in the transmissive phase in A. castellanii were induced in the sessile cells as compared to the suspension cells. Since CsrA is known to downregulate flagellar gene expression in L. pneumophila (Fettes et al., 2001
), this observation suggests that the regulatory networks are modified in the biofilm as compared to planktonic life. Such modification may allow expression of L. pneumophila traits required for the biofilm lifestyle such as the flagella although CsrA is induced. This observation is in line with a recent report that expression of flagella is maintained throughout all stages of E. coli biofilm development (Domka et al., 2007
). Searching for genes predicted to encode proteins involved in extracellular matrix generation revealed lpl2186 encoding a putative poly-β-hydroxyalkanoate (PHA) synthase that is repressed in L. pneumophila sessile cells with respect to the planktonic populations. Interestingly, Pham et al. (2004)
have suggested that PHA accumulation in P. aeruginosa is in competition with alginate biosynthesis and that the PHA-negative mutant formed a stable biofilm with large, distinct and differentiated microcolonies characteristic of alginate-overproducing strains of P. aeruginosa.
A stringent analysis of the biofilm-regulated genes highlighted seven genes whose expression was at least threefold altered in sessile cells with respect to both planktonic cell populations. Among these genes were the clusters pvcAB and ahpC2D. The first encodes proteins homologous to PvcA and PvcB that are required for production of the siderophore pyoverdine in P. aeruginosa. However, there are differences between L. pneumophila and P. aeruginosa regarding the pvc genes. First, we demonstrated that their expression in L. pneumophila increases in response to high iron concentrations in broth culture, while they are repressed under these conditions in P. aeruginosa. Second, the pvc locus of P. aeruginosa contains four genes, pvcABCD, whereas only pvcA and pvcB are present in the L. pneumophila genome (Stintzi et al., 1999
). Third, pvc-like genes of L. pneumophila might not be involved in siderophore activity, since pvc mutants showed no difference as compared to the wild-type strain in chrome azurol S assays (Allard et al., 2006
). It is thus likely that the function of the pvcA and pvcB products in L. pneumophila is different from that in P. aeruginosa. The second gene cluster, including ahpC2 and ahpD, whose products are alkyl hydroperoxide reductases, displayed the highest induction in biofilm cells. These proteins are known to play a role in protection against oxidative stress (Rocha & Smith, 1999
; Le Blanc et al., 2006
).
Interestingly, iron is known to participate in the production of reactive oxygen intermediates (Andrews et al., 2003
). In its soluble, reduced state (Fe2+) iron is toxic; its oxidation by oxygen to Fe3+ induces production of hazardous intermediate reactive species. Oxidative stress and iron metabolism are often related. In Neisseria meningitidis, an iron-induced operon is required for protection against hydrogen peroxide-mediated killing (Grifantini et al., 2004
) and in Campylobacter jejuni, induced expression of ahpC under iron limitation is believed to counterbalance the intracellular accumulation of iron due to active acquisition systems induced under these conditions (Baillon et al., 1999
). Induction of both pvcAB and ahpC2D genes in sessile cells could thus be related and reflect the need for protection against oxidative stress resulting from high iron concentrations. A possible explanation is that the pvc genes, encoding proteins putatively involved in synthesis of siderophore-like molecules, may contribute to iron sequestration and/or uptake in order to maintain iron concentration below a toxic level. Interestingly, proteomic studies on a P. aeruginosa biofilm revealed the induction of AhpC, together with L-ornithine 5-monooxygenase, whose gene is located within the pvd locus involved in pyoverdine synthesis (Visca et al., 1994
; Sauer et al., 2002
). In contrast, transcriptome analyses of P. aeruginosa biofilms (Whiteley et al., 2001
; Waite et al., 2005
) revealed no induction of the pyoverdine genes, except when the gene expression profile of biofilm cells was compared to that of cells released from the biofilm (Sauer et al., 2004
). However, only pvcAB appeared to be iron-regulated during the planktonic lifestyle, suggesting that iron does not constitute the only signal inducing expression of the biofilm-regulated genes. Accordingly, the expression of other iron-regulated genes, as described by Cianciotto (2007)
, was not significantly altered in sessile cells. In addition, except the ahp genes, no other gene encoding proteins related to resistance to oxidative stress (Table S1) was induced in the sessile cells, suggesting that sessile cells undergo a moderate oxidative stress. Nevertheless, high iron concentrations (a fivefold increase in iron pyrophosphate concentration) appear detrimental to the sessile mode of life since our experiments revealed a strong inhibition of biofilm formation under these conditions. Interestingly, it has already been shown that iron salts perturb biofilm formation of P. aeruginosa (Musk et al., 2005
). It has also been proposed that a critical level of intracellular iron serves as the signal for biofilm development (Singh, 2004
; Banin et al., 2005
). The L. pneumophila pvcA mutant showed no significant difference in biofilm formation whatever the tested iron concentration. The product of pvcA alone is thus not essential either for biofilm formation by L. pneumophila or for protection of sessile cells against high iron concentrations. Its induction in sessile cells might therefore be triggered by an unknown signal rather than by an iron-rich environment. Alternatively, pvcA inactivation may be compensated for by another L. pneumophila gene.
In conclusion, these first results on in vitro biofilm formation of L. pneumophila and the characterization of its transcriptional profile provide the basis for a better understanding of the sessile mode of life of L. pneumophila. It will be challenging to explore the fine interactions between iron, oxidative stress and biofilm formation.
| ACKNOWLEDGEMENTS |
|---|
Edited by: S. C. Andrews
| REFERENCES |
|---|
|
|
|---|
Allard, K. A., Viswanathan, V. K. & Cianciotto, N. P. (2006). lbtA and lbtB are required for production of the Legionella pneumophila siderophore legiobactin. J Bacteriol 188, 1351–1363.
Andrews, S. C., Robinson, A. K. & Rodriguez-Quinones, F. (2003). Bacterial iron homeostasis. FEMS Microbiol Rev 27, 215–237.[CrossRef][Medline]
Baillon, M. L., van Vliet, A. H., Ketley, J. M., Constantinidou, C. & Penn, C. W. (1999). An iron-regulated alkyl hydroperoxide reductase (AhpC) confers aerotolerance and oxidative stress resistance to the microaerophilic pathogen Campylobacter jejuni. J Bacteriol 181, 4798–4804.
Banin, E., Vasil, M. L. & Greenberg, E. P. (2005). Iron and Pseudomonas aeruginosa biofilm formation. Proc Natl Acad Sci U S A 102, 11076–11081.
Beloin, C., Valle, J., Latour-Lambert, P., Faure, P., Kzreminski, M., Balestrino, D., Haagensen, J. A., Molin, S., Prensier, G. & other authors (2004). Global impact of mature biofilm lifestyle on Escherichia coli K-12 gene expression. Mol Microbiol 51, 659–674.[CrossRef][Medline]
Brüggemann, H., Hagman, H., Jules, M., Sismeiro, O., Dillies, M. A., Gouyette, C., Kunst, F., Steinert, M., Heuner, K. & other authors (2006). Virulence strategies for infecting phagocytes deduced from the in vivo transcriptional program of Legionella pneumophila. Cell Microbiol 8, 1228–1240.[CrossRef][Medline]
Cazalet, C., Rusniok, C., Bruggemann, H., Zidane, N., Magnier, A., Ma, L., Tichit, M., Jarraud, S., Bouchier, C. & other authors (2004). Evidence in the Legionella pneumophila genome for exploitation of host cell functions and high genome plasticity. Nat Genet 36, 1165–1173.[CrossRef][Medline]
Chien, M., Morozova, I., Shi, S., Sheng, H., Chen, J., Gomez, S. M., Asamani, G., Hill, K., Nuara, J. & other authors (2004). The genomic sequence of the accidental pathogen Legionella pneumophila. Science 305, 1966–1968.
Cianciotto, N. P. (2007). Iron acquisition by Legionella pneumophila. Biometals 20, 323–331.[CrossRef][Medline]
De Buck, E., Maes, L., Meyen, E., Van Mellaert, L., Geukens, N., Anne, J. & Lammertyn, E. (2005). Legionella pneumophila Philadelphia-1 tatB and tatC affect intracellular replication and biofilm formation. Biochem Biophys Res Commun 331, 1413–1420.[CrossRef][Medline]
Declerck, P., Behets, J., van Hoef, V. & Ollevier, F. (2007). Detection of Legionella spp. and some of their amoeba hosts in floating biofilms from anthropogenic and natural aquatic environments. Water Res 41, 3159–3167.[Medline]
Delmar, P., Robin, S. & Daudin, J. J. (2005). VarMixt: efficient variance modelling for the differential analysis of replicated gene expression data. Bioinformatics 21, 502–508.
Domka, J., Lee, J., Bansal, T. & Wood, T. K. (2007). Temporal gene-expression in Escherichia coli K-12 biofilms. Environ Microbiol 9, 332–346.[CrossRef][Medline]
Donlan, R. M. & Costerton, J. W. (2002). Biofilms: survival mechanisms of clinically relevant microorganisms. Clin Microbiol Rev 15, 167–193.
Fettes, P. S., Forsbach-Birk, V., Lynch, D. & Marre, R. (2001). Overexpresssion of a Legionella pneumophila homologue of the E. coli regulator csrA affects cell size, flagellation, and pigmentation. Int J Med Microbiol 291, 353–360.[CrossRef][Medline]
Grifantini, R., Frigimelica, E., Delany, I., Bartolini, E., Giovinazzi, S., Balloni, S., Agarwal, S., Galli, G., Genco, C. & other authors (2004). Characterization of a novel Neisseria meningitidis Fur and iron-regulated operon required for protection from oxidative stress: utility of DNA microarray in the assignment of the biological role of hypothetical genes. Mol Microbiol 54, 962–979.[CrossRef][Medline]
Hall-Stoodley, L., Costerton, J. W. & Stoodley, P. (2004). Bacterial biofilms: from the natural environment to infectious diseases. Nat Rev Microbiol 2, 95–108.[CrossRef][Medline]
Heuner, K., Brand, B. C. & Hacker, J. (1999). The expression of the flagellum of Legionella pneumophila is modulated by different environmental factors. FEMS Microbiol Lett 175, 69–77.[CrossRef][Medline]
Johnson, M., Cockayne, A., Williams, P. H. & Morrissey, J. A. (2005). Iron-responsive regulation of biofilm formation in Staphylococcus aureus involves Fur-dependent and Fur-independent mechanisms. J Bacteriol 187, 8211–8215.
Kim, B. R., Anderson, J. E., Mueller, S. A., Gaines, W. A. & Kendall, A. M. (2002). Literature review – efficacy of various disinfectants against Legionella in water systems. Water Res 36, 4433–4444.[Medline]
Kuiper, M. W., Wullings, B. A., Akkermans, A. D., Beumer, R. R. & van der Kooij, D. (2004). Intracellular proliferation of Legionella pneumophila in Hartmannella vermiformis in aquatic biofilms grown on plasticized polyvinyl chloride. Appl Environ Microbiol 70, 6826–6833.
LeBlanc, J. J., Davidson, R. J. & Hoffman, P. S. (2006). Compensatory functions of two alkyl hydroperoxide reductases in the oxidative defense system of Legionella pneumophila. J Bacteriol 188, 6235–6244.
Livak, K. J. & Schmittgen, T. D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2–
CT method. Methods 25, 402–408.[CrossRef][Medline]
Mampel, J., Spirig, T., Weber, S. S., Haagensen, J. A., Molin, S. & Hilbi, H. (2006). Planktonic replication is essential for biofilm formation by Legionella pneumophila in a complex medium under static and dynamic flow conditions. Appl Environ Microbiol 72, 2885–2895.
Milohanic, E., Glaser, P., Coppee, J. Y., Frangeul, L., Vega, Y., Vazquez-Boland, J. A., Kunst, F., Cossart, P. & Buchrieser, C. (2003). Transcriptome analysis of Listeria monocytogenes identifies three groups of genes differently regulated by PrfA. Mol Microbiol 47, 1613–1625.[CrossRef][Medline]
Molofsky, A. B. & Swanson, M. S. (2003). Legionella pneumophila CsrA is a pivotal repressor of transmission traits and activator of replication. Mol Microbiol 50, 445–461.[CrossRef][Medline]
Molofsky, A. B. & Swanson, M. S. (2004). Differentiate to thrive: lessons from the Legionella pneumophila life cycle. Mol Microbiol 53, 29–40.[CrossRef][Medline]
Murga, R., Forster, T. S., Brown, E., Pruckler, J. M., Fields, B. S. & Donlan, R. M. (2001). Role of biofilms in the survival of Legionella pneumophila in a model potable-water system. Microbiology 147, 3121–3126.
Musk, D. J., Banko, D. A. & Hergenrother, P. J. (2005). Iron salts perturb biofilm formation and disrupt existing biofilms of Pseudomonas aeruginosa. Chem Biol 12, 789–796.[CrossRef][Medline]
O'Toole, G. A. & Kolter, R. (1998). Flagellar and twitching motility are necessary for Pseudomonas aeruginosa biofilm development. Mol Microbiol 30, 295–304.[CrossRef][Medline]
Pham, T. H., Webb, J. S. & Rehm, B. H. (2004). The role of polyhydroxyalkanoate biosynthesis by Pseudomonas aeruginosa in rhamnolipid and alginate production as well as stress tolerance and biofilm formation. Microbiology 150, 3405–3413.
Piao, Z., Sze, C. C., Barysheva, O., Iida, K. & Yoshida, S. (2006). Temperature-regulated formation of mycelial mat-like biofilms by Legionella pneumophila. Appl Environ Microbiol 72, 1613–1622.
Pratt, L. A. & Kolter, R. (1998). Genetic analysis of Escherichia coli biofilm formation: roles of flagella, motility, chemotaxis and type I pili. Mol Microbiol 30, 285–293.[CrossRef][Medline]
Reiner, A., Yekutieli, D. & Benjamini, Y. (2003). Identifying differentially expressed genes using false discovery rate controlling procedures. Bioinformatics 19, 368–375.
Robey, M. & Cianciotto, N. P. (2002). Legionella pneumophila feoAB promotes ferrous iron uptake and intracellular infection. Infect Immun 70, 5659–5669.
Rocha, E. R. & Smith, C. J. (1999). Role of the alkyl hydroperoxide reductase (ahpCF) gene in oxidative stress defense of the obligate anaerobe Bacteroides fragilis. J Bacteriol 181, 5701–5710.
Saby, S., Vidal, A. & Suty, H. (2005). Resistance of Legionella to disinfection in hot water distribution systems. Water Sci Technol 52, 15–28.[Medline]
Sauer, K., Camper, A. K., Ehrlich, G. D., Costerton, J. W. & Davies, D. G. (2002). Pseudomonas aeruginosa displays multiple phenotypes during development as a biofilm. J Bacteriol 184, 1140–1154.
Sauer, K., Cullen, M. C., Rickard, A. H., Zeef, L. A., Davies, D. G. & Gilbert, P. (2004). Characterization of nutrient-induced dispersion in Pseudomonas aeruginosa PAO1 biofilm. J Bacteriol 186, 7312–7326.
Schembri, M. A., Kjaergaard, K. & Klemm, P. (2003). Global gene expression in Escherichia coli biofilms. Mol Microbiol 48, 253–267.[CrossRef][Medline]
Shirtliff, M. E., Mader, J. T. & Camper, A. K. (2002). Molecular interactions in biofilms. Chem Biol 9, 859–871.[CrossRef][Medline]
Singh, P. K. (2004). Iron sequestration by human lactoferrin stimulates P. aeruginosa surface motility and blocks biofilm formation. Biometals 17, 267–270.[CrossRef][Medline]
Soderberg, M. A., Rossier, O. & Cianciotto, N. P. (2004). The type II protein secretion system of Legionella pneumophila promotes growth at low temperatures. J Bacteriol 186, 3712–3720.
Steinert, M., Hentschel, U. & Hacker, J. (2002). Legionella pneumophila: an aquatic microbe goes astray. FEMS Microbiol Rev 26, 149–162.[CrossRef][Medline]
Stintzi, A., Cornelis, P., Hohnadel, D., Meyer, J. M., Dean, C., Poole, K., Kourambas, S. & Krishnapillai, V. (1996). Novel pyoverdine biosynthesis gene(s) of Pseudomonas aeruginosa PAO. Microbiology 142, 1181–1190.
Stintzi, A., Johnson, Z., Stonehouse, M., Ochsner, U., Meyer, J. M., Vasil, M. L. & Poole, K. (1999). The pvc gene cluster of Pseudomonas aeruginosa: role in synthesis of the pyoverdine chromophore and regulation by PtxR and PvdS. J Bacteriol 181, 4118–4124.
Thomas, V., Bouchez, T., Nicolas, V., Robert, S., Loret, J. F. & Levi, Y. (2004). Amoebae in domestic water systems: resistance to disinfection treatments and implication in Legionella persistence. J Appl Microbiol 97, 950–963.[CrossRef][Medline]
Visca, P., Ciervo, A. & Orsi, N. (1994). Cloning and nucleotide sequence of the pvdA gene encoding the pyoverdin biosynthetic enzyme L-ornithine N5-oxygenase in Pseudomonas aeruginosa. J Bacteriol 176, 1128–1140.
Waite, R. D., Papakonstantinopoulou, A., Littler, E. & Curtis, M. A. (2005). Transcriptome analysis of Pseudomonas aeruginosa growth: comparison of gene expression in planktonic cultures and developing and mature biofilms. J Bacteriol 187, 6571–6576.
Watnick, P. I. & Kolter, R. (1999). Steps in the development of a Vibrio cholerae El Tor biofilm. Mol Microbiol 34, 586–595.[CrossRef][Medline]
Watnick, P. & Kolter, R. (2000). Biofilm, city of microbes. J Bacteriol 182, 2675–2679.
Whiteley, M., Bangera, M. G., Bumgarner, R. E., Parsek, M. R., Teitzel, G. M., Lory, S. & Greenberg, E. P. (2001). Gene expression in Pseudomonas aeruginosa biofilms. Nature 413, 860–864.[CrossRef][Medline]
Yang, Y. H., Dudoit, S., Luu, P., Lin, D. M., Peng, V., Ngai, J. & Speed, T. P. (2002). Normalization for cDNA microarray data: a robust composite method addressing single and multiple slide systematic variation. Nucleic Acids Res 30, e15
Received 10 April 2007;
revised 31 July 2007;
accepted 17 August 2007.
This article has been cited by other articles:
![]() |
M. Musken, S. Di Fiore, A. Dotsch, R. Fischer, and S. Haussler Genetic determinants of Pseudomonas aeruginosa biofilm establishment Microbiology, February 1, 2010; 156(2): 431 - 441. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kimura, K. Tateda, Y. Ishii, M. Horikawa, S. Miyairi, N. Gotoh, M. Ishiguro, and K. Yamaguchi Pseudomonas aeruginosa Las quorum sensing autoinducer suppresses growth and biofilm production in Legionella species Microbiology, June 1, 2009; 155(6): 1934 - 1939. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wu and F. W. Outten IscR Controls Iron-Dependent Biofilm Formation in Escherichia coli by Regulating Type I Fimbria Expression J. Bacteriol., February 15, 2009; 191(4): 1248 - 1257. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. F. Clarke-Pearson and S. F. Brady Paerucumarin, a New Metabolite Produced by the pvc Gene Cluster from Pseudomonas aeruginosa J. Bacteriol., October 15, 2008; 190(20): 6927 - 6930. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. LeBlanc, A. K. C. Brassinga, F. Ewann, R. J. Davidson, and P. S. Hoffman An Ortholog of OxyR in Legionella pneumophila Is Expressed Postexponentially and Negatively Regulates the Alkyl Hydroperoxide Reductase (ahpC2D) Operon J. Bacteriol., May 15, 2008; 190(10): 3444 - 3455. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |