| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
1 Institute of Molecular and Cellular Biology, Faculty of Biological Sciences, University of Leeds, Leeds, UK
2 Fermentation Biotechnology Research, National Center for Agricultural Utilization Research, Peoria, IL 61604, USA
3 School of Medicine, Faculty of Medicine and Health, University of Leeds, Leeds, UK
Correspondence
Simon R. Carding
Simon.Carding{at}BBSRC.ac.uk
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
The GenBank accession number for the B. ovatus promoter and operon is EU334491.
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
; Whitman et al., 1998). The gut microbiota has been shown to influence the development and function of the gut mucosal immune system, which becomes tolerant to or fails to mount a response to the gut bacteria (Savage, 1999). A breakdown in immune tolerance to members of the microbiota has been shown to be a contributing factor in the pathogenesis of inflammatory bowel disease (IBD) (Baumgart & Carding, 2007). Altering the microbiota through the use of prebiotics and probiotics to improve or restore gastrointestinal health has become an intense area of research. In particular, the use of genetically modified bacteria to deliver biologically active, immunomodulatory molecules directly to the gut has become an increasingly attractive area of investigation in the search for new therapeutic options for chronic intestinal inflammation and IBD. Proof-of-principle studies using Lactococcus lactis have shown that this organism can produce and secrete biologically active human cytokines that can be used to successfully treat intestinal inflammation in animal models (Steidler et al., 1995, 1998, 2000). Although effective, these genetically modified probiotics have certain drawbacks such as an inability to regulate the production of the therapeutic molecule, requiring repeated oral administration of the organism to colonize the gut.
To attempt to overcome the drawbacks of the L. lactis system, we have utilized Bacteroides ovatus, a commensal of the human colon that can utilize xylan as its sole source of carbohydrates, as a potentially improved genetically modified probiotic. Xylans are a major component of plant cell wall polysaccharides that cannot be degraded by digestive enzymes produced by humans and other animals. Commensal colonic bacteria such as B. ovatus have a major role in their degradation through the production of xylanolytic enzymes (Salyers et al., 1981; Whitehead & Hespell, 1990). To date, however, only two of the genes involved in xylan degradation by B. ovatus have been cloned and little is known about their regulation. Whitehead & Hespell (1990) identified a region of the B. ovatus chromosome encoding a xylanase (xylI) and a bifunctional xylosidase–arabinosidase (xsa). It was subsequently shown that these two genes are part of an operon that may include other genes and that xsa is the last gene in this operon (Weaver et al., 1992; Whitehead, 1995). This operon is under the control of a xylan-inducible promoter, the disruption of which adversely affects the growth of B. ovatus on xylan (Weaver et al., 1992). Our previous work utilized this operon to enable the mouse cytokine interleukin-2 (IL-2) to be produced in response to xylan in the culture medium (Farrar et al., 2005). However, insertion of the IL-2 gene into the known part of the xylanase operon disrupted transcription of the xylanase genes. Lack of xylanase production by the recombinant organisms may result in a competitive disadvantage when introduced into the gut.
To generate strains of B. ovatus capable of producing therapeutic proteins in a xylan-inducible manner without disruption of the xylanase operon, the promoter of this operon must be used. Therefore, the initial objective of the current study was to clone and sequence all genes within the xylanase operon and the promoter region. We also present data to show that the putative xylanase operon promoter we have identified is regulated by xylan and can be used to drive expression of a heterologous human gene, leading to production of a recombinant, biologically active protein that is important in maintaining gut barrier function.
|
METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
was grown in LB medium supplemented with ampicillin (100 µg ml–1) or kanamycin (50 µg ml–1) when required. Cultures of E. coli J53/R751 were supplemented with trimethoprim (200 µg ml–1). Bacteroides ovatus V975 was grown anaerobically at 37 °C in brain heart infusion (BHI; Oxoid) medium supplemented with 0.001 % (w/v) haemin. For cultures with defined carbon sources, B. ovatus was grown in routine growth medium (RGM; Hespell et al., 1987) supplemented with 0.001 % (w/v) haemin. Glucose and xylan were added as required. When xylan was required, a hot-water-soluble fraction of oat spelt xylan (Sigma) was prepared as described by Hespell & O'Bryan (1992). B. ovatus transconjugants were selected on BHI-haemin agar containing gentamicin (200 µg ml–1) and tetracycline (5 µg ml–1). Suicide plasmids pBT2 (Tancula et al., 1992) and pCQW1 (Feldhaus et al., 1991) were used to transfer DNA into B. ovatus from E. coli J53/R751 and E. coli HB101, respectively, by conjugation as described by Valentine et al. (1992). pCR-Blunt (Invitrogen) was used for cloning blunt-ended PCR products and pUC18 for cloning other DNA fragments. E. coli was transformed by the method of Hanahan (1983). B. ovatus genomic DNA was isolated by the NaCl/CTAB method described by Wilson (1997). General DNA manipulations were carried out as described by Sambrook et al. (1990). Growth of bacteria on different media was monitored by measuring OD600.
Cloning of the xylanase operon promoter by inverse PCR.
A fragment of B. ovatus genomic DNA containing the xylanase operon promoter was identified and cloned as follows. First, B. ovatus genomic DNA was digested with various restriction endonucleases, separated by agarose gel electrophoresis and transferred to a nylon membrane by the method of Southern (1975). To generate a probe, a 600 bp EcoRI–KpnI fragment of the incomplete xylanase operon was isolated from plasmid pOX1 (Whitehead & Hespell, 1990) and labelled with digoxigenin (DIG)-11-UTP using the DIG High Prime Labelling and Detection Starter kit (Roche). The probe was then hybridized with the digested B. ovatus genomic DNA and visualized according to the manufacturer's instructions. The xylanase operon promoter was cloned by digesting B. ovatus genomic DNA to completion with HindIII, which cuts within a 3.8 kb region of the B. ovatus xylanase operon previously sequenced (Whitehead & Hespell, 1990). Digested DNA was diluted 200-fold then self-ligated. Ligation products were purified by phenol/chloroform extraction and used as template DNA in a PCR with primers BOPRO1 (GAATAGCAAAACCAGTCAGCGG) and BOPRO2 (AGTTCCGGTAAGGATGTCGCA) using the Expand Long Template PCR System (Roche) according to the manufacturer's instructions. The PCR product was gel-purified, treated with T4 DNA polymerase and T4 polynucleotide kinase in a one-step blunting and 5' phosphorylation procedure, then cloned into pCR-Blunt for sequencing. The GenBank accession number for the sequence is EU334491.
Rapid amplification of 5' cDNA ends (5'RACE).
Total RNA was extracted from B. ovatus cells grown in RGM with 0.1 % (w/v) glucose and 0.2 % (w/v) xylan, using the SV Total RNA Isolation System (Promega). cDNA synthesis was performed using 1–2 µg of total RNA template, 12.5 pmol of primer SP1 (CAATTCCATATTCGACTGTCCC), 2 mM of each dNTP and 20 U M-MuLV reverse transcriptase (New England Biolabs) according to the manufacturer's instructions. The reaction was carried out for 1 h at 42 °C, followed by heat inactivation. cDNA was purified using the QiaQuick PCR Clean-up kit (Qiagen) then 3' polyadenylated using 80 U terminal transferase (Roche) according to the manufacturer's instructions. Polyadenylated cDNA was used as a template in a PCR with the anchor d(T) (CCACGCGTGAATTCGTCGACT16V) and SP1 primers, and the resulting product subjected to a second and third round of PCR with an anchor forward primer (CCACGCGTGAATTCGTCGAC) and nested reverse primers SP2 (GAACATACCCAAACATCGCCAATAAG) and SP3 (CTTTAATTCGATATCATTAATGGCCATC), respectively. The PCR product was cloned and sequenced to identify the transcription initiation site (TIS).
Construction of B. ovatus XylE reporter strains.
The promoterless xylE gene (encoding catechol 2,3-dioxygenase) of the Pseudomonas putida TOL plasmid was isolated from pLEC23 (Coyne et al., 2003; Zukowski et al., 1983) by digestion with BamHI and PstI, and cloned into BamHI/PstI-digested pUC18. The putative B. ovatus xylanase operon promoter was PCR-amplified using primers XYLP-f (GCGGATCCTGGGGAGTATCGGACAATG) and XYLP-r (GAGGATCCTCTGTCTTTCTTTTATATGTCTTTATTTC) (BamHI sites in bold), digested with BamHI and cloned into the BamHI site upstream of xylE in pUC18 in both the forward (ON) and reverse (OFF) orientations. Orientations were confirmed by sequencing. The promoter-xylE fragment was isolated by digestion with HindIII and KpnI and cloned into pBT2. The construct was then transferred by conjugation to B. ovatus and integration into the genome confirmed by PCR. Screening for XylE enzyme activity in individual colonies was performed by spraying plates with 50 mM catechol, with a yellow product indicating XylE activity. XylE mRNA expression was detected by RT-PCR using primers XYLE-f (ATTCACCATCCGGAAAAAGG) and XYLE-r (GAGAATGCGGTCGTGGTAAA).
Generation of the B. ovatus xylanase operon disruption mutant 
G1.
A 509 bp region from the first gene in the xylanase operon was PCR amplified using primers GENE1F1 (TTACTTCCGGCTGGGCAACAAA) and GENE1R1 (GACATTCGATTCTCCCTGATACCA), and the PCR product was recovered using the TA cloning kit and cloned into the vector pCR2.1 (Invitrogen) according to the manufacturer's instructions. The resultant plasmid was then digested with BamHI and SstI, and the genomic insert recovered and ligated into pCQW1 (Feldhaus et al., 1991) digested with the same enzymes. The suicide vector was transferred to B. ovatus by conjugation from E. coli HB101 and transconjugants were selected as previously described (Weaver et al., 1992).
Construction of trefoil-factor-secreting B. ovatus (BO-TFF3).
The coding region of human trefoil factor 3 (TFF-3) was PCR-amplified from a cDNA clone (IMAGE clone ID 4696566, MRC Geneservices) using Pfu DNA polymerase (Promega) and primers TFF-f (GACATATGAAGAATGTAAAGTTACTTTTAATGCTAGGAACCGCGGCATTATTAGCTGCAGAGGAGTACGTGGGCCTC; NdeI site in bold) that contained the Bacteroides fragilis enterotoxin secretion signal coding sequence (underlined) and TFF-r (GCAAGCTTTCAGAAGGTGCATTCTGCTTC; HindIII site in bold). The B. ovatus xylanase operon promoter was PCR-amplified using primers XYLP-f and XYLP-rn (GTCATATGGTCTTTCTTTTATATGTCTTTATTTCATG; NdeI site in bold). The promoter and TFF-3 PCR products were cloned into pCR-Blunt to create plasmids pCR-Pro and pCR-TFF-3 respectively. The TFF-3 coding region was removed from pCR-TFF-3 by digestion with NdeI and HindIII then ligated into NdeI/HindIII-digested pCR-XYLP. The putative xylanase promoter-TFF-3 fragment was then isolated by double digestion with HindIII and XbaI and cloned into a suitable site in pBT2 to produce pBT-TFF. pBT-TFF was transferred to B. ovatus by conjugation from E. coli J53/R751 and integration of the plasmid into the genome confirmed by PCR.
Reverse transcription (RT)-PCR to confirm transcription of intergenic regions.
Total RNA was isolated using the SV Total RNA isolation System (Promega) according to the manufacturer's protocol. Purified RNA was treated with TURBO DNase (Ambion). cDNA synthesis was performed using 1–2 µg of total RNA, 4 µM random nonamers, 0.5 mM of each dNTP and 200 U M-MuLV reverse transcriptase (New England Biolabs) according to the manufacturer's instructions. The reaction was carried out for 1 h at 42 °C followed by heat inactivation. Two microlitres of the cDNA was used in the subsequent PCR along with the following primers: JUNC1-F, CGAGTGGCAGCAGCTATCTT; JUNC1-R, ACCAGAGGATCCCAAAGGAC; JUNC2-F, CTTTTGCCGAACAGGGAATA; JUNC2-R, CAAAGCCTTTTTCAGCGAAC; JUNC3-F, ATCGCAATTATCAGCCGAAG; JUNC3-R, ACCGTTCATCACATCATCCA; XYLP, GATTAAAGAAGGGGAGAGTG, TIS, CCCTTTCCTCTTGTTTATCGGTG.
Real-time RT-PCR analysis of xylanase operon transcription.
B. ovatus was grown in RGM supplemented with various concentrations of glucose and/or xylan. Total RNA was isolated and prepared for cDNA synthesis as described above. RNA was reverse transcribed using random hexamers and M-MuLV reverse transcriptase (New England Biolabs) according to the manufacturer's instructions. Real-time PCR was carried out using iQ SYBR Green supermix (Bio-Rad) and the iCycler thermal cycler (Bio-Rad); 400 nM primers were used in 25 µl reaction volumes. Primers were QPCR2-F (AATTCCAGTGTCGGAGGTTC) and QPCR2-R (CAGCGACTCCATCAAATCGT) for the ORF1 gene of the xylanase operon, and GYRA.F (TTCCGGATGTTAGAGATGGA) and GYRA.R (CCAAGTACCTCACCCACGAT) for the housekeeping gene gyrA. Quantification of mRNA was performed using the standard curve method, with the quantity of ORF1 normalized to the amount of gyrA product for each condition to determine gene expression relative to gyrA.
TFF-3 quantification.
A direct ELISA was used to quantify levels of TFF-3 produced by recombinant strains of B. ovatus. Briefly, 96-well ELISA plates (Nunc Maxisorp) were coated overnight at 4 °C with 100 µl of twofold serial dilutions of bacterial culture supernatants. Plates were washed three times with PBS/0.05 % (v/v) Tween 20 then blocked with 300 µl 10 % (w/v) BSA in PBS at 20 °C for 1 h. After three washes with PBS/Tween, 100 µl TFF-3 monoclonal antibody (1 : 250; clone 3G11, Abnova) was added to each well and the plate incubated at room temperature for 2 h. The plate was washed five times with PBS/Tween, then 100 µl of a 1 : 1800 dilution of biotinylated goat anti-mouse IgG (Vector Lab) and 1 : 250 streptavidin-HRP added and incubated at 20 °C for 1 h. The plate was washed seven times, then peroxidase substrate [1 : 1, v/v, 2,2'-azino-di-(3-ethylbenzthiazoline-6-sulfonate)] added and incubated for 30 min at 20 °C. A standard curve was obtained from serial dilutions of recombinant TFF-3 (Abnova). Samples were assayed in duplicate.
TFF bioassay.
TFF-3 bioactivity was assessed using the colorectal cancer epithelial cell line HT-29 in an epithelial cell migration assay as previously described (Jeffers et al., 2002). Briefly, confluent monolayers of HT-29 cells were grown in 12-well plates in RPMI containing 10 % (v/v) fetal calf serum at 37 °C in a humidified atmosphere of 5 % (v/v) CO2 in air. Cells were washed with PBS and cultured for a further 24 h in serum-free medium. Wounds were made by scraping the cell monolayer with a disposable pipette tip. Monolayers were then washed with PBS and incubated in serum-free medium in the presence of recombinant TFF-3 (Abnova) or culture supernatants of B. ovatus V975 and BO-TFF3 grown with xylan. The rate of wound closure was calculated by measuring the size of the wound opening at 0 and 8 h.
Statistical analysis.
SPSS statistical software (v.14) was used to analyse data. Groups were compared using one-way ANOVA. Where P
0.05, the difference was considered significant.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
were identified, as was the ORF2 upstream of xylI that had previously been partially sequenced. This ORF2 comprised 1413 bp, encoding a protein of 471 aa with a predicted molecular mass of 52.4 kDa. This protein was identified as a putative sodium/sugar symporter with 64 % identity to a putative sodium symporter gene of Prevotella bryantii (Fig. 1a). A second ORF (ORF1) of 1656 bp was identified further upstream, encoding a protein of 552 aa with a predicted molecular mass of 62.1 kDa and a predicted 58 % homology with sialic-acid-specific 9-O-acetylesterase of Bacteroides vulgatus, and 17.3 % homology with the putative arylesterase/lipase of Prevotella bryantii (Fig. 1a). Functional assays are required to confirm the identity of these xylanase operon genes. As no further ORFs were identified, the xylanase operon of B. ovatus was determined to comprise four genes (Fig. 1a). To confirm that all four genes were part of the same operon, the first gene of the operon (putative acetylesterase) was inactivated by insertional disruption. The resulting mutant (G1) demonstrated reduced growth on xylan, similar to that seen with disruption of the xylI gene (Weaver et al., 1992). Growth in medium containing glucose was unaffected (Fig. 1b). Furthermore, RT-PCR analysis of G1 showed that the xsa gene of the xylanase operon was not expressed when the mutant was grown on xylan (data not shown), and RT-PCR amplification of the junctional region sequences between the ORF1 and ORF2, ORF2 and xylI, and xylI and xsa genes of the wild-type organism generated amplification products of the expected sizes (Fig. 1c). Together, these results confirm that four genes constitute the xylanase operon, which appears to be under the control of a single promoter. xsa was considered the last gene in this operon, as shown previously (Weaver et al., 1992).
|
), which was homologous to the first 5 bp of the putative consensus sequence of P. bryantii (Miyazaki et al., 2003). A similar AT-rich sequence was also observed 4–12 bp upstream of the start codon of all four xylan utilization genes (Fig. 2b). Cloning of the putative promoter region upstream of the promoterless xylE gene in the forward orientation resulted in catechol 2,3-dioxygenase activity in E. coli whereas no enzyme activity was detected when the promoter was in the reverse orientation. The xylE reporter construct was introduced into B. ovatus and integrated into the genome by homologous recombination in the promoter region. It was not possible, however, to detect XylE enzyme activity among any of the recombinants using optimal culture conditions. Therefore, xylE reporter gene expression was analysed by RT-PCR. As seen in Fig. 3, xylE transcripts were only detected in B. ovatus containing the promoter-xlyE reporter in the forward orientation, confirming that this region of DNA was able to drive transcription in B. ovatus.
|
|
). At higher xylan concentrations promoter activity was reduced. Maximum levels of xylanase operon expression occurred within 2 h of exposure to xylan and expression persisted for up to 24 h (Fig. 4b). Glucose suppressed xylan-induced promoter activity at concentrations as low as 0.025 % (w/v) (Fig. 4c).
|
). Additional RT-PCR assays were performed to confirm the identity of the putative TIS and to determine if additional TIS existed upstream. No PCR products were obtained using a primer XYLP (Fig. 2c) upstream of the TIS, which contrasted with the large amount of product detected using the same reverse primer in combination with a forward primer complementary to the putative TIS (Fig. 2c). The DNA sequence adjacent to the TIS revealed motifs of AT-rich character, including TTCTAA centred on –9 and TGTAAT centred on –23. No inverted repeat sequences indicative of binding sites for one or more regulatory proteins were found in the promoter sequence. Close inspection of the putative xylanase promoter sequence in Fig. 2(a) revealed the presence of a Bacteroides consensus promoter (Bayley et al., 2000) at –74 relative to the ATG translational start codon. It is possible that this represents a second TIS; however, as only one TIS was identified by 5'RACE this promoter may not be active under the conditions used in our experiments. Therefore, the TIS identified in this study is likely to be the primary TIS.
Utilization of the xylanase promoter for the controlled production of functional human trefoil factor (TFF-3) by B. ovatus
A strain of B. ovatus capable of producing and secreting human TFF-3 in a xylan-inducible manner was constructed. TFF-3, or intestinal trefoil factor (ITF), was chosen on the basis of its role in protecting and repairing the intestinal mucosal barrier (Dignass et al., 1994; Mashimo et al., 1996) and its potential use as a therapeutic agent in chronic inflammatory disorders of the intestine. The region of the TFF-3 gene encoding the 59 aa mature protein was cloned under the control of the xylanase promoter in pCR-Blunt to generate the plasmid pCR-TFF. The B. fragilis endotoxin secretion signal sequence was introduced 5' of the TFF-3 coding sequence to mediate secretion of the recombinant protein. The use of an NdeI site for cloning resulted in 3 bp change (AGA to CAT) in the non-coding region, which was outside the predicted RBS of the promoter and was not expected to affect translation. The promoter-TFF fragment was cloned into pBT2 to create pBT-PTFF (Fig. 5a), which was then successfully transferred to B. ovatus V975 to create BO-TFF3.
|
).
The functional activity of TFF-3 produced by recombinant strains was tested by its effect on HT-29 intestinal epithelial cell migration (Fig. 5c). Culture supernatant from BO-TFF3 cultured with xylan significantly enhanced HT-29 cell restitution and wound closure (P=0.01) compared to cultures in serum-deprived medium alone or after supplementation with culture supernatant from B. ovatus V975 (P=0.035 and 0.017 respectively). Wound closure rates in the presence of B. ovatus V975 conditioned medium or with serum-deprived medium alone were comparable. The closure rate seen with 10-fold diluted BO-TFF3 conditioned medium was comparable to that seen with 15 ng ml–1 recombinant TFF-3. These results demonstrate that BO-TFF3 produces biologically active TFF-3 in a xylan-inducible manner, and that modification of the 5' end of the gene encoding the recombinant protein had no adverse affect on the biological activity of TFF-3.
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
Two new genes were sequenced that completed the xylanase operon. These encode a putative sodium/sugar symporter and sialic-acid-specific 9-O-acetylesterase, both of which would be expected to complement the activity of the xylI and xsa gene products in the degradation of xylan. Grass xylans frequently have acetyl groups attached by ester linkages (Hespell & Whitehead, 1990) that would be removed by the esterase, and the symporter would mediate the transport of liberated xylose and arabinose residues into the cell.
The TIS of the xylanase promoter was located well upstream of the translation initiation codon at –216. Such a large distance is not unusual and has been described for bacterial genes in other species, for example Porphyromonas gingivalis (Jackson et al., 2000) and Prevotella loescheii (Manch-Citron et al., 1999), which is closely related to Bacteroides spp. This is important in considering this promoter for the controlled expression of heterologous or homologous genes. The sequences at positions –10 or –35 upstream of the start site did not resemble any known RNA polymerase recognition sequences in E. coli, but, given the large difference in consensus sequences that have been identified between E. coli and other species, B. ovatus may have unique RNA polymerase recognition sequences. This possibility is supported by the unconventional promoter motifs of B. fragilis that have been previously identified (Bayley et al., 2000). However, no similarity with B. fragilis consensus sequences could be identified in the B. ovatus xylanase promoter. This may not, however, be entirely unexpected since the absence of these consensus sequences in the recA and sod genes of B. fragilis (Bayley et al., 2000) suggests that these consensus sequences may not strictly apply to all Bacteroides promoters. To define the regulatory region(s) in the promoter a detailed deletion and point mutation analysis is required.
The reporter gene xylE was used successfully in B. fragilis in plasmid pLEC23 (Coyne et al., 2003). We therefore tried to use xylE to characterize the xylanase promoter. However, we were unable to detect XylE enzyme activity after integration into chromosomal DNA. It is unlikely that XylE is not functional in B. ovatus as it was shown to be functional in B. fragilis; however, in that study it was integrated into an expression plasmid vector (Coyne et al., 2003). The lack of XylE expression in B. ovatus recombinants may be a consequence of integration of a single copy into the chromosomal DNA as compared to multiple plasmid-encoded copies in E. coli transformants and B. fragilis producing high levels of catechol dioxygenase activity. The xylanase operon promoter was upregulated by xylan and expression increased with increasing xylan concentration up to 0.05 % (w/v). Expression was, however, reduced at higher xylan concentrations and by the addition of glucose. Glucose repression has been previously described for the Streptomyces lividans xylanase promoter (Chen & Westpheling, 1998). However, the direct repeat or inverted repeat sequences present in the S. lividans promoter are not present in the B. ovatus xylanase promoter. Furthermore, the B. ovatus xylanase promoter reaches maximal expression 2–4 h after induction. These features may be utilized by B. ovatus to improve the efficiency of polysaccharide digestion and maximize the nutritional effect. It is possible that this promoter and the xylan operon could be used to improve xylan utilization by rumen bacteria, especially as xylosidase and not xylanase activity is the rate-limiting step in xylan breakdown by B. ovatus (Weaver et al., 1992).
We have previously used the xylan-inducible nature of B. ovatus xylan utilization genes to direct the controlled production of murine IL-2 (Farrar et al., 2005). However, integration of the IL-2 gene into the xylanase operon may adversely affect the ability of the engineered B. ovatus to colonize the colon (S. R. Carding, unpublished observations). In the work presented here, the integrity of the xylanse operon was maintained, increasing the prospect of using engineered B. ovatus strains in probiotic regimens. The feasibility of using the xylanase promoter to control the expression of a human gene is demonstrated here using human TFF-3 as a test protein. To control human TFF-3 expression the mature part of the protein was positioned downstream of the xylanase promoter and translationally fused to the B. fragilis enterotoxin secretion signal sequence. This signal sequence was shown previously to mediate secretion of recombinant protein (Farrar et al., 2005). Although the correct folding of the human protein and preservation of the triple loop structural motifs required for biological activity (Thim et al., 1993) was a major concern, high levels of biologically active protein were secreted by BO-TFF3.
In summary, we have developed a novel system for the controlled in vivo delivery of biologically active human proteins that may in the future be of use in the controlled delivery of a variety of human proteins directly to the mucosal surface for the treatment of chronic intestinal inflammatory disorders. This system has distinct advantages over other genetically modified bacteria that have been used in phase I clinical trials (Braat et al., 2006), in which cytokine production cannot be regulated (Steidler et al., 2000). For recombinant strains of B. ovatus to be effective in patients, the subjects may have to be placed on a xylan-reduced (low-fibre) diet to prevent inappropriate expression of xylan-regulated heterologous gene expression in vivo.
|
ACKNOWLEDGEMENTS |
|---|
Edited by: H. J. Flint
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
Bayley, D. P., Rocha, E. R. & Smith, C. J. (2000). Analysis of cepA and other Bacteroides fragilis genes reveals a unique promoter structure. FEMS Microbiol Lett 193, 149–154.[CrossRef][Medline]
Braat, H., Rottiers, P., Hommes, D. W., Huyghebaert, N., Remaut, E., Remon, J. P., van Deventer, S. J., Neirynck, S., Peppelenbosch, M. P. & Steidler, L. (2006). A phase I trial with transgenic bacteria expressing interleukin-10 in Crohn's disease. Clin Gastroenterol Hepatol 4, 754–759.[CrossRef][Medline]
Chen, C.-C. & Westpheling, J. (1998). Partial characterization of the Streptomyces lividans xlnB promoter and its use for expression of a thermostable xylanase from Thermotoga maritima. Appl Environ Microbiol 64, 4217–4225.
Coyne, M. J., Weinacht, K. G., Krinos, C. M. & Comstock, L. E. (2003). Mpi recombinase globally modulates the surface architecture of a human commensal bacterium. Proc Natl Acad Sci U S A 100, 10446–10451.
Dignass, A., Lynch-Devaney, K., Kindon, H., Thim, L. & Podolsky, D. K. (1994). Trefoil peptides promote epithelial migration through a transforming growth factor β-independent pathway. J Clin Invest 94, 376–384.[Medline]
Egert, M., de Graaf, A. A., Smidt, H., de Vos, W. M. & Venema, K. (2006). Beyond diversity: functional microbiomics of the human colon. Trends Microbiol 14, 86–91.[CrossRef][Medline]
Farrar, M. D., Whitehead, T. R., Lan, J., Dilger, P., Thorpe, R., Holland, K. T. & Carding, S. R. (2005). Engineering of the gut commensal bacterium Bacteroides ovatus to produce and secrete biologically active murine interleukin-2 in response to xylan. J Appl Microbiol 98, 1191–1197.[CrossRef][Medline]
Feldhaus, M. J., Hwa, V., Cheng, Q. & Salyers, A. A. (1991). Use of an Escherichia coli β-glucuronidase gene as a reporter gene for investigation of Bacteroides promoters. J Bacteriol 173, 4540–4543.
Hanahan, D. (1983). Studies on transformation of Escherichia coli with plasmids. J Mol Biol 166, 557–580.[Medline]
Hespell, R. B. & O'Bryan, P. J. (1992). Purification and characterization of an -l-arabinofuranosidase from Butyrivibrio fibrisolvens GS113. Appl Environ Microbiol 58, 1082–1088.
Hespell, R. B. & Whitehead, T. R. (1990). Physiology and genetics of xylan degradation by gastrointestinal tract bacteria. J Dairy Sci 73, 3013–3022.[Abstract]
Hespell, R. B., Wolf, R. & Bothast, R. (1987). Fermentation of xylans by Butyrivibrio fibrisolvens and other ruminal bacteria. Appl Environ Microbiol 53, 2849–2853.
Jackson, C. A., Hoffmann, B., Slakeski, N., Cleal, S., Hendtlass, A. J. & Reynolds, E. C. (2000). A consensus Porphyromonas gingivalis promoter sequence. FEMS Microbiol Lett 186, 133–138.[CrossRef][Medline]
Jeffers, M., McDonald, W. F., Chillakuru, R. A., Yang, M., Nakase, H., Deegler, L. L., Sylander, E. D., Rittman, B. & Bendele, A. (2002). A novel human fibroblast growth factor treats experimental intestinal inflammation. Gastroenterology 123, 1151–1162.
Manch-Citron, J. N.., Dey, A., Schneider, R. & Nguyen, N. (1999). The translational hop junction and the 5' transcriptional start site for the Prevotella loescheii adhesin encoded by plaA. Curr Microbiol 38, 22–26.[CrossRef][Medline]
Mashimo, H., Wu, D. C., Podolsky, D. K. & Fishman, M. C. (1996). Impaired defense of intestinal mucosa in mice lacking intestinal trefoil factor. Science 274, 262–265.
Miyazaki, K., Miyamoto, H., Mercer, D. K., Hirase, T., Martin, J. C., Kojima, Y. & Flint, H. J. (2003). Involvement of the multidomain regulatory protein XynR in positive control of xylanase gene expression in the ruminal anaerobe Prevotella bryantii B14. J Bacteriol 185, 2219–2226.
Salyers, A. A., Gherardini, F. & O'Brien, M. (1981). Utilization of xylan by two species of human colonic Bacteroides. Appl Environ Microbiol 41, 1065–1068.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1990). Molecular Cloning: a Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Savage, D. C. (1999). Mucosal microbiota. In Mucosal Immunology, pp. 19–30. Edited by P. Ogra, J. Mestecky, M. Lamm, W. Strober, J. Bienenstock & J. McGhee. San Diego: Academic Press.
Southern, E. M. (1975). Detection of specific sequences among DNA fragments separated by gel electrophoresis. J Mol Biol 98, 503–517.[CrossRef][Medline]
Steidler, L., Wells, J. M., Raeymaekers, A., Vandekerckhove, J., Fiers, W. & Remaut, E. (1995). Secretion of biologically active murine interleukin-2 by Lactococcus lactis subsp. lactis. Appl Environ Microbiol 61, 1627–1629.[Abstract]
Steidler, L., Robinson, K., Chamberlain, L., Schofield, K. M., Remaut, E., Le Page, R. W. F. & Wells, J. M. (1998). Mucosal delivery of murine interleukin-2 (IL-2) and IL-6 by recombinant strains of Lactococcus lactis coexpressing antigen and cytokine. Infect Immun 66, 3183–3189.
Steidler, L., Hans, W., Schotte, L., Neirynck, S., Obermeier, F., Falk, W., Fiers, W. & Remaut, E. (2000). Treatment of murine colitis by Lactococcus lactis secreting interleukin-10. Science 289, 1352–1355.
Tancula, E., Feldhaus, M. J., Bedzyk, L. A. & Salyers, A. A. (1992). Location and characterization of genes involved in binding of starch to the surface of Bacteroides thetaiotaomicron. J Bacteriol 174, 5609–5616.
Thim, L., Norris, K., Norris, F., Nielsen, P. F., Bjorn, S. E., Christensen, M. & Petersen, J. (1993). Purification and characterization of the trefoil peptide human spasmolytic polypeptide (hSP) produced in yeast. FEBS Lett 318, 345–352.[CrossRef][Medline]
Valentine, P. J., Arnold, P. & Salyers, A. A. (1992). Cloning and partial characterization of two chromosomal loci from Bacteroides ovatus that contain genes essential for growth on guar gum. Appl Environ Microbiol 58, 1541–1548.
Weaver, J., Whitehead, T. R., Cotta, M. A., Valentine, P. C. & Salyers, A. A. (1992). Genetic analysis of a locus on the Bacteroides ovatus chromosome which contains xylan utilization genes. Appl Environ Microbiol 58, 2764–2770.
Whitehead, T. R. (1995). Nucleotide sequences of xylan-inducible xylanase and xylosidase/arabinosidase genes from Bacteroides ovatus V975. Biochim Biophys Acta 1244, 239–241.[Medline]
Whitehead, T. R. & Hespell, R. B. (1990). The genes for three xylan-degrading activities from Bacteroides ovatus are clustered in a 3.8-kilobase region. J Bacteriol 172, 2408–2412.
Whitman, W. B., Coleman, D. C. & Wiebe, W. J. (1998). Prokaryotes: the unseen majority. Proc Natl Acad Sci U S A 95, 6578–6583.
Wilson, K. (1997). Preparation of genomic DNA from bacteria. In Current Protocols in Molecular Biology. Edited by M. Ausubel, R. Brent, R. Kingston, D. Moore, J. Seidman, J. Smith & K. Struhl. New York: Wiley.
Zukowski, M. M., Gaffney, D. F., Speck, D., Kauffmann, M., Findeli, A., Wisecup, A. & Lecocq, J.-P. (1983). Chromogenic identification of genetic regulatory signals in Bacillus subtilis based on expression of a cloned Pseudomonas gene. Proc Natl Acad Sci U S A 80, 1101–1105.
Received 3 April 2008;
revised 30 June 2008;
accepted 10 July 2008.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |
