| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Institute for Microbiology and Biotechnology, University of Ulm, D-89069 Ulm, Germany
Correspondence
Ulrike Gerischer
ulrike.gerischer{at}uni-ulm.de
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
Present address: Ratiopharm GmbH, Ulm, Germany. |
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
; Halford & Marko, 2004). Some regulatory proteins recognize multiple specific binding sites, which in most cases have a similar but not identical sequence. Aligning such known binding sites makes it possible to deduce which positions of the binding sites are crucial, as has been done, for example, for the cAMP receptor protein (CRP) of Escherichia coli or more recently for the Vfr protein from Pseudomonas aeruginosa (Kanack et al., 2006; Kolb et al., 1993). Other regulators have only one or a few known binding sites, which is not sufficient to determine a consensus sequence. In such cases the relevance of certain nucleotides within a regulator binding site can be evaluated in a powerful experimental approach whereby randomly modified binding sites are offered to the protein in different screening setups (SELEX: systematic evolution of ligands by exponential enrichment). This approach has been used, for example, to determine the binding site of the CopR repressor from Bacillus subtilis (Freede & Brantl, 2004) and to define promoter recognition by 
F in the same bacterium (Amaya et al., 2001).
The PcaU protein from Acinetobacter baylyi is an IclR-type transcriptional regulator involved in the control of gene expression in aromatic compound degradation (Gerischer et al., 1998). In this bacterium, aromatic compounds are converted to protocatechuate or catechol by a number of funnelling pathways. These compounds are the starting molecules for the breakdown of the aromatic core by the ortho cleavage (also referred to as the β-ketoadipate) pathway (Harwood & Parales, 1996). All enzymes necessary for protocatechuate degradation are encoded by the pca genes, which form an operon. This operon includes the cluster of four downstream qui genes involved in the conversion of the hydroaromatic compounds quinate and shikimate (pca-qui operon, Fig. 1; Dal et al., 2005). The pcaU gene is located upstream of this large (14 kb) operon and transcribed divergently from it. The 309 bp intergenic region between pcaU and the pca-qui operon (PcaU is shorter than originally determined; B. Jerg and U. Gerischer, unpublished observation) contains the large (45 bp) PcaU binding site (Fig. 1) (Popp et al., 2002). It contains three perfectly conserved 10 bp repeats, here referred to as R1, R2 and R3. R1 and R2 form a palindrome; R3 is a direct sequence repeat of R2 separated by 10 bp. This architecture makes the PcaU binding site exceptional in comparison with binding sites of other regulator proteins, which are most frequently formed by a sequence of less perfectly conserved sequence motifs with dyad symmetry (Tropel & van der Meer, 2004).
|
). The same pattern of expression has been observed for the pcaU gene itself. Besides the PcaU-dependent expression control of the pca-qui operon, there are at least two more systems controlling pca-qui operon and pcaU expression which act at higher levels and in both cases reduce expression (Gerischer et al., 2008). Cross-regulation applies when in addition to substrates degraded via protocatechuate, substrates of a parallel branch (with catechol as the central compound) of the pathway are offered simultaneously. This situation leads to repression of pcaU gene and pca-qui operon expression (Brzostowicz et al., 2003; Siehler et al., 2007). The two regulators BenM and CatM are involved in this mechanism. They are primarily responsible for the activation of expression of the ben and cat genes, which encode enzymes of the second branch of the pathway for the breakdown of benzoate and catechol. The third regulatory level recognized is carbon catabolite repression of pcaU and the pca-qui operon upon the simultaneous presence of an aromatic substrate and the organic acids acetate and succinate (Dal et al., 2002; Siehler et al., 2007).
Given the central relevance of PcaU binding to the expression of two transcripts, as well as the fact that understanding of the molecular mechanism of the function of IclR-type regulators is still limited (Molina-Henares et al., 2006), it seemed interesting to analyse the relevance of the PcaU binding site for gene expression and for PcaU binding alone. Here we describe experiments in which the PcaU binding site has been randomly modified and incorporated into the organism. Derivatives of the PcaU binding site that enabled the cell to express the pca-qui operon at enhanced levels were selected and characterized. In a further approach, in vitro screening of randomly modified PcaU binding sites was performed, searching for sequences that were still bound by PcaU.
|
METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
. A. baylyi strains were cultivated at 30 °C in mineral medium, as described previously (Trautwein & Gerischer, 2001), supplemented with the carbon sources lactose (10 mM), succinate (10 mM) or p-hydroxybenzoate (5 mM as sole carbon source or 1 mM in addition to lactose for induction). Antibiotics for A. baylyi strains were used at the following concentrations: kanamycin, 12 µg ml–1; spectinomycin, 100 µg ml–1; streptomycin, 10–50 µg ml–1. E. coli strains were grown in Luria broth supplemented with the appropriate antibiotic (ampicillin, 100 µg ml–1) at 37 °C.
|
fragment from plasmid pHP4 ). Plasmid pAC46 was cleaved with MscI and PmlI, releasing a 699 bp pcaU internal fragment. The fragment (SmaI-cut) was inserted and insertion was confirmed by the streptomycin resistance of the respective clones. The resulting plasmid (pAC94) was verified by restriction analysis. A fragment containing the modified pcaU gene was released with the restriction enzymes SnaBI/AflIII and used to transform A. baylyi strains, followed by selection on mineral medium with succinate supplied with streptomycin (10 µg ml–1). The specific integration of the DNA fragment into the Acinetobacter genomes was confirmed by whole-cell PCR with primers ON3000 and UI-2604 (Table 2).
|
) contained a randomized PcaU binding site (41 nucleotides containing R1, R2 and R3, plus one additional nucleotide on either side replaced by GGATCATTTGTAATTGGTACGATATTTAGTATCTATCATGACG). It was constructed by overlap-extension PCR using plasmid pZR9 as a template; the resulting fragment was cleaved with EcoRI and NcoI (at sites native to A. baylyi), resulting in a 335 bp fragment, which was cloned into the insert in pAC40, resulting in plasmid pAC53.
|
Genetic modification of Acinetobacter by natural transformation.
Recipient strains of A. baylyi were transformed with restriction fragments or DNA fragments produced by PCR, as described previously (Trautwein & Gerischer, 2001).
Determination of luciferase activity.
All data reported are representative of at least three independent experiments. Aliquots of cell suspensions were withdrawn every hour, covering the complete growth curve, and the OD600 was measured. The reservoirs of the luminometer (Flash'n Glow, Berthold Detection Systems) were filled with 2.5x assay buffer (62.5 mM glycylglycine, pH 7.8, 25 mM MgCl2) and 33 µM D-luciferin (freshly dissolved in water). After placing the sample tube with 150 µl cell suspension into the luminometer, 150 µl of each solution was added and the luminescence was immediately measured for 15 s at 22 °C. Light emission was given in relative light units (RLU) and normalized to the OD600 of the bacterial culture at the respective time. The SD for multiple measurements from the same cell suspension was no more than 2 %. To characterize expression levels, we used the reporter gene activity in the mid-exponential growth phase. The SD for this value was up to 30 % between different cultures grown under identical conditions.
Expression and purification of His-tagged and native PcaU from E. coli.
The pcaU gene, including its ribosome-binding site, was amplified from A. baylyi chromosomal DNA using primers Chitin1 and His1. The PCR product was ligated into the TA cloning vector pDrive. The pcaU-containing fragment was subsequently isolated by NotI/NdeI cleavage and ligated into the NotI/NdeI-digested expression vector pET29(+) to produce plasmid pAC115. Sequencing of the insertion confirmed the absence of accidental mutations. The PcaU fusion protein possesses six histidyl residues at the C terminus and is therefore referred to as PcaU–6His. Synthesis of the fusion protein was induced in recombinant E. coli BL21-AI by the addition of 1 mM IPTG, L(+)-arabinose (0.2 g l–1) and glucose (0.1 g l–1) after the culture had reached OD600 0.6, and cells were then incubated for 4 h at 30 °C. The cells were disrupted with a French pressure cell, and purification of the fusion protein was performed by Ni2+ affinity chromatography. Native PcaU was produced and purified using plasmid pAC7, as described previously (Popp et al., 2002).
Gel retardation assay.
The DNA probes containing the PcaU binding site were generated by whole-cell PCR of A. baylyi strains ADPU100–ADPU124 with the primer pair UI-2604 and pZR-Seq1. The resulting DNA fragments (193 bp) were radiolabelled using T4 polynucleotide kinase. The labelled fragments were purified via size exclusion by Sephadex G-25 (MicroSpin G-25 columns, Amersham Biosciences). The assay was performed as described elsewhere (Popp et al., 2002). For the determination of the dissociation constant (Kd) the quantity of the unretarded probe as a percentage of the total amount of probe employed in one assay was plotted against the concentration of PcaU protein in the assay. The Kd was the PcaU concentration at which 50 % of the probe had been retarded. In all cases, the concentration of the DNA probe was significantly lower than the PcaU concentration (Carey, 1991). Each Kd determination was repeated at least three times, and the maximum SD was 30 %.
Mutagenesis of the PcaU binding site in vivo.
Random mutations were introduced into the PcaU binding site using a mutagenic oligonucleotide (ON1; Table 2
, Fig. 1a). At either end, the oligonucleotide carried wild-type sequence (Table 2). A 1540 bp DNA fragment was created in a three-step PCR procedure, starting with the mutagenic oligonucleotide ON1 (Fig. 2) to enable subsequent incorporation into the chromosome of A. baylyi by homologous recombination. The PCRs were designed to avoid incorporation of the wild-type PcaU binding site sequence into the fragment. Therefore, in PCR 1, a fragment was produced from chromosomal DNA of A. baylyi that was adjacent to the PcaU binding site but did not contain it. The resulting 245 bp fragment was used as a template for PCR 2, which ON1 was used as one of the primers, resulting in the incorporation of the mutations. PCR 3 was used to extend the fragment. Plasmid pAC53 (containing a randomized, dysfunctional PcaU binding site) was used as a template; the 316 bp fragment that had been produced in PCR 2 served as one of the primers. The resulting 1540 bp fragment consisted of the randomly mutated PcaU binding site and unmodified DNA corresponding to the wild-type sequence at either side (1245 bp in the direction of pcaU, 245 bp in the direction of pcaI).
To introduce these fragments carrying the randomly mutated PcaU binding site into the genome of A. baylyi, we took advantage of a strain with a 220 bp deletion in the pcaU–pcaI intergenic area which removes pcaIp (A. baylyi strain ADPU1) (Fig. 1b) (Dal et al., 2005). This strain is not able to grow on substrates that are degraded via protocatechuate because of the lack of the main promoter pcaIp, which drives the expression of the pca-qui operon. Furthermore, it lacks part of the PcaU binding site. Using the mutagenic PCR product described (Fig. 2), strain ADPU1 was transformed successfully, even though the overlapping DNA available for base pairing on one side of the deletion (within the pcaI gene) was only 47 bp. Growth on an aromatic substrate degraded via protocatechuate (p-hydroxybenzoate) indicated that the transformants had incorporated a DNA sequence that allowed pca gene expression. Whole-cell PCR revealed the incorporation of the 220 bp that were missing in the recipient strain ADPU1.
Isolation of modified PcaU binding sites by in vitro selection.
The 90 bp oligonucleotide ON1 containing a randomly mutagenized PcaU binding site was converted into double-stranded DNA and simultaneously radiolabelled by incorporation of [
-32P]dATP using Klenow enzyme and ON2758 as a primer. After performing a gel retardation assay with purified native PcaU protein, the mixture was separated on a native gel (12 % polyacrylamide; Fig. 3). The native PcaU binding site on a 214 bp EcoRI/XmnI restriction fragment labelled with Klenow fragment was included as a control. DNA was isolated from the area containing the retarded ON1 material (Sambrook & Russell, 2001) and amplified by PCR using primers ON2669/XhoI and ON2758/HindIII. The resulting fragment was cleaved with XhoI and HindIII and cloned into pBluescript II SK(+) prepared with the same enzymes. The sequences of the insertions were determined using IRD-labelled M13/pUC primer on a LI-COR 4000L Sequencer (MWG Biotech) and a SequiTherm EXCEL II DNA Sequencing Kit-LC (Epicentre).
|
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
), each position would be mutated with a likelihood of 0.15; each alternative nucleotide should be incorporated with the same likelihood (0.05). The mutated area (50 nt) should therefore carry an average of 7.5 mutations per molecule. The sequences of the PcaU binding sites of 24 such strains were determined (Fig. 4).
|
). All of these had significant numbers of mutations in the control group of sequences (between 11 and 21 % with respect to all analysed sequences determined in the ON1 pool of molecules prior to selection, as described below). Only the cytosine within R3 and the thymine directly in front of R3 cannot be considered; this is because in the control group there were only one and two mutations, respectively, at these positions (2 and 4 %, respectively, open arrows in Fig. 4). Four of these conserved positions are located within R1 (or directly adjacent to R1 in one case) and one is located within R3, which fits with the overall frequency of mutations described above. Another interesting observation is that the insertions and deletions (in strains ADPU114, ADPU116, ADPU118 and ADPU121) did not eliminate PcaU-dependent expression, even though this kind of mutation obviously modifies the spacing of sequence elements.
Effect of the mutated PcaU binding sites on pca-qui gene expression
To analyse how the expression from the pcaIp promoter is affected by the characterized PcaU binding-site derivatives under inducing and non-inducing conditions, a luc reporter gene (encoding firefly luciferase) was introduced into the pcaI gene of each of the 24 strains creating a transcriptional fusion between the first gene of the pca-qui operon and the luc gene. Furthermore, we inactivated the pcaU gene in all 24 mutant strains containing the pcaI–luc fusion to analyse the role of PcaU in activation and repression of the pca-qui operon with the modified PcaU binding sites. Therefore, a 699 bp internal fragment of pcaU was deleted and replaced by a cassette designed to interrupt both translation and transcription (Prentki & Krisch, 1984). The luciferase activity of those strains (with and without pcaU) was tested under inducing and non-inducing conditions (growth on mineral medium with 10 mM lactate, induction by 1 mM p-hydroxybenzoate; Fig. 4). p-Hydroxybenzoate is converted into protocatechuate in these strains but further metabolism is not possible due to the insertion of the luciferase cassette into pcaI, blocking the pathway at the level of protocatechuate. Thus, the inducer protocatechuate is present throughout the course of the growth experiment. Lactate was chosen because it has no repressing effect (Dal et al., 2002).
Despite the presence of the mutations in the PcaU binding site, induction of the pca operon was still possible, but in almost all cases the level of induction was lower than in the wild-type (40 000 relative light units at OD600 1). The lowest induction observed among the mutant strains was fivefold for strain ADPU108.
Under non-inducing conditions, the basal expression level is negatively controlled by PcaU (columns B and R in Fig. 4). Most of the mutants displayed only minor changes in basal expression level, except for five strains, in which it increased between fivefold and 46-fold. Comparison of the basal expression level of strains containing PcaU with the strains without PcaU allowed the calculation of the repressive effect of PcaU. Most of the mutant strains had lost part or all of this repression. In a few cases repression was as strong as or even stronger than that of the wild-type, which coincided with a decreased basal expression level in the strains with PcaU. We also measured the strains without PcaU under inducing conditions to see if induction had ceased or was being mediated by an unknown component. Almost all PcaU-negative strains displayed no significant change in the presence of inducer. Two strains (ADPU107, ADPU108) showed a 3.5-fold increase, which might be an indication of an unknown alternative regulator causing this effect (data not shown).
Interaction of PcaU with modified binding sites
Gel retardation assays were used to analyse the effect of different mutations in the PcaU binding site on the PcaU–DNA interaction. Therefore, the affinity of purified PcaU–6His protein for the modified PcaU binding sites was determined (Fig. 4). PcaU–6His has been shown to bind to the unmodified PcaU binding site with a somewhat lower affinity than the native PcaU [Kd 1.9 versus 0.16 nM (Popp et al., 2002)]; therefore, all comparisons of affinities were carried out for measurements made with the same PcaU preparation. All mutated PcaU binding sites still bound PcaU–6His specifically. The presence of modified binding sites resulted in a decrease in the binding affinity in most cases (down to ninefold weaker binding in strain ADPU101), but in four cases the binding affinity was close to that observed in the wild-type. A correlation between reduced binding affinity and lower induced expression level could be observed in a number of strains (for example ADPU112), indicating the relevance of the binding affinity of PcaU for its binding site to transcriptional response. In other cases this correlation was not observed (for example strain ADPU101); here other factors must compensate for the loss of binding site affinity of PcaU.
Identification of modified PcaU binding sites based on their affinity for PcaU
In the approach described above, modified PcaU binding sites were identified that allowed PcaU binding and transcriptional activity (recruitment of RNA polymerase and enhancement of its activity at pcaIp). The results led to the question as to whether sequence conservation is less important when considering PcaU binding alone versus regulation of pca-qui operon expression. To answer this question, mutated PcaU binding sites were screened for their ability to bind to PcaU in vitro. To achieve this, the same synthetic oligonucleotide as in the in vivo strategy (ON1) was used. After synthesis of the second strand and radioactive labelling, the pool of randomly modified PcaU binding sites (10 pmol per assay) was applied to an electrophoretic mobility shift assay to select sequences that were capable of binding to native PcaU. PcaU protein was applied in excess (20 and 60 pmol), which led to specific binding of 0.1 and 0.5 pmol of DNA molecules, as revealed by quantification of the retarded band (Fig. 3). Despite a considerable surplus of PcaU, only a small proportion of the DNA molecules were bound (1 and 5 %, respectively) indicating that the majority of modified binding sites were not specifically recognized by PcaU and therefore were not retarded in the gel. In contrast, a fragment containing the wild-type PcaU binding site was retarded efficiently by 20 pmol protein (Fig. 3).
The bound DNA was eluted from the gel and amplified via PCR. The primers contained sites for restriction cleavage, which allowed subsequent cloning and sequencing. None of the 57 plasmids analysed contained the wild-type sequence. The number of mutations at each individual position varied between one and 20 with an average of 11. The average number of mutations per molecule was 9.6.
As a control for the distribution of mutations in the mutagenic oligonucleotide, it was amplified without prior selection, cloned into the sequencing vector and sequenced. A total of 48 sequences were determined. The average number of mutations per molecule was 8.3, which was slightly higher than the expected number of 7.5 mutations per molecule. The distribution of mutations at each position varied (one–17 mutations per position among 48 molecules, average eight). Therefore, the mutation frequency after selection by PcaU was normalized against the mutation frequency prior to selection. Positions with a significantly lower occurrence of mutations after selection by PcaU binding as compared to the control pool without selection are considered to be important for the PcaU–DNA interaction, and therefore conserved (open arrows in Fig. 5). The normalization was intended to focus the analysis on the changes between the two pools of sequences and not on the variation in mutation between the different positions caused by the different coupling efficiencies of the oligonucleotide synthesis. This normalization was not applied to the in vivo experiment described above because the selection criteria applied there (protocatechuate-dependent induction at pcaIp) were much more stringent than attachment to a DNA fragment.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
The 24 mutant strains identified by the in vivo approach revealed that the three sequence repetitions R1, R2 and R3, and the spacer region between R2 and R3, undergo mutations at significantly different frequencies. R1 is clearly the area with the lowest number of mutations and therefore is indicated to be most relevant to the biological function of PcaU. The R2 sequence accumulated the highest number of mutations and therefore is indicated to be less important for the function of PcaU. It is unlikely that this 10 bp sequence has no relevance because in this case its sequence would not be perfectly identical with the R1 and R3 sequences. R3 seems to have an intermediate level of importance for in vivo PcaU function. The observation that the spacer region between R2 and R3 acquires a significantly lower number of mutations than R2 is unexpected and is an indication that this region fulfils a function in the binding site. Five positions could be identified that never carried a mutation, indicating the relevance of these positions in the process of PcaU-dependent gene regulation.
The effect of the mutated PcaU binding sites on gene expression was investigated. All 24 mutant strains showed an increase in pca-qui expression in the presence of protocatechuate, even though in most cases to a lesser extent than the wild-type. The diminished induction was due to (i) a reduced maximal expression level or (ii) an increased basal expression level, or both. In these strains the positioning of the regulator is probably not optimal, allowing only a reduced expression level. No binding site modification resulted in a significantly higher induction than in the wild-type. Clearly the native PcaU binding site has a sequence optimized for high induction upon protocatechuate binding.
The uninduced expression levels (basal levels) on the other hand stayed at a similar level (0.5–2.0-fold increase in roughly half of the strains) or increased significantly (up to 46-fold). Here, two things may have happened. Firstly, the mutations may have potentiated the nearby promoter of the pca-qui operon. Secondly, the repressing effect of PcaU at the wild-type DNA binding site may have been diminished. This could be observed for most strains with a significantly increased level of basal expression.
In addition to the expression data, the affinity of PcaU for the modified binding sites was determined. In all cases PcaU bound specifically, an expected observation, since the gene expression data had already indirectly shown that a PcaU-dependent activity could be observed. None of the modified binding sites bound PcaU significantly more tightly than the wild-type sequence, an observation that has also been made for other regulators like CopR (Freede & Brantl, 2004).
Of interest with respect to the spatial organization of the binding site are four binding sites in which insertions and/or deletions (of one nucleotide in each case) had occurred. Due to the nature of the screening, these changes must still allow gene expression, demonstrating that certain rearrangements are possible.
In the in vitro approach, eight positions were identified at which mutations occurred to a significantly lesser extent than in the control group. These positions are indicated to be relevant for PcaU binding alone. Clearly, there are differences between these positions and the ones found to be most conserved in the in vivo approach. This may be a reflection of several additional parameters that influence the performance of the PcaU binding site in vivo: (i) for induced expression, protocatechuate is bound by PcaU, and this complex may have a different DNA binding requirement from that of PcaU without inducer; (ii) the interaction with RNA polymerase is likely to be part of the regulatory process, and this interaction may also change the DNA binding requirement. Despite this, in two cases the same positions were seen to be conserved with both approaches, namely the two guanosines within R1. These positions seem to be uniquely important, in both PcaU binding alone and the complete process of PcaU-dependent gene regulation.
The PcaU protein has a second binding site directly downstream of its own gene. It contains all three sequence repetitions, although they are less well conserved. Binding of PcaU to this site has been demonstrated. In this case, only the palindromic area is bound and the binding is weaker than that to the intergenic binding site (Popp et al., 2002). Despite these differences, this second PcaU binding site displays all the residues that have been identified as conserved in the current investigation by both the in vivo and the in vitro approaches, supporting their relevance in both binding sites.
Of all 540 recognized members of the IclR family (Bairoch et al., 2005; Krell et al., 2006; Mulder et al., 2005) only a small number (20 regulators) have been investigated experimentally, and only for some of them is the binding site known. A conserved IclR-type DNA binding site cannot be found, but for a subgroup within the family (namely the PcaU/PobR/PcaR group) there is a conserved sequence motif (Fig. 6) covering a palindromic 17 bp sequence. The two guanosine nucleotides in R1 identified in the current study as being strongly conserved by both the in vivo and the in vitro approach also turn out to be moderately to completely conserved in comparisons between different binding sites (Fig. 6). The other arm of the palindrome (corresponding to R2) did not display completely conserved residues with the in vivo approach, but the guanosine residue found to be conserved by the in vitro approach is also completely conserved in the alignment shown in Fig. 6. Thus, three positions shown to be important for PcaU binding and/or activity are also conserved in binding sites of related regulators of the IclR subfamily.
|
). The core sequence is a highly conserved 15 bp palindromic motif, which overlaps the –35 motif of the promoter of the first regulated gene (aceB).
Among the six structures of IclR family members that are publicly accessible (www.pdb.org) there is one full-length protein referred to as IclR from Thermotoga maritima (Zhang et al., 2002). From the structural data strong evidence can be deduced that the protein is active as a tetramer. Since the DNA target of this protein is unknown, the authors modelled the binding site from E. coli IclR interacting with the T. maritima tetramer. This resulted in the suggestion that T. maritima IclR is likely to interact with a binding site consisting of two palindromes, a constellation that is partially found in the PcaU binding site. Also, A. baylyi PobR and Pseudomonas putida PcaR have binding sites that exceed a simple palindrome thus indicating that all members of the PcaU/PobR/PcaR group may act as tetramers. In the case of the IclR member AllR from E. coli, residues Cys135–Cys142 have been predicted to be involved in the tetramerization, and mutations in this region made the respective proteins functionally inactive in vivo (Walker et al., 2006).
Taken together, the mutagenesis of the complex binding site of A. baylyi PcaU revealed that the three sequence motifs R1, R2 and R3 have differential relevance to pca-qui operon regulation in vivo, with R1 being the least susceptible to mutations and therefore most important, and R2 being least important. Four positions within (or adjacent to) the 10 bp sequence motif R1 were conserved and therefore required for in vivo function, whereas other positions could be mutated. All modified binding sites changed the transcriptional response of the controlled promoter, pcaIp, by changing its activating or its repressing quality, or both. All mutant binding sites displayed a lower affinity for PcaU, which was in part, although not systematically, correlated with changes in the transcriptional output. Other effects of the mutated DNA binding site seem to be more relevant to transcriptional regulation; for example, the exact positioning of the regulator with respect to the RNA polymerase–promoter complex. The results of the in vitro screening partially overlapped with those of the in vivo screening, confirming the relevance of the respective positions for both PcaU binding alone and the complete process of PcaU-dependent gene regulation. Considering the unusual qualities of the binding site as well as the dual functionality (positive as well as negative regulation of the same promoter), it will be most interesting to unravel more details of the function of this regulator.
|
ACKNOWLEDGEMENTS |
|---|
Edited by: M. A. Kertesz
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
Amaya, E., Khvorova, A. & Piggot, P. J. (2001). Analysis of promoter recognition in vivo directed by F of Bacillus subtilis by using random-sequence oligonucleotides. J Bacteriol 183, 3623–3630.
Bairoch, A., Apweiler, R., Wu, C. H., Barker, W. C., Boeckmann, B., Ferro, S., Gasteiger, E., Huang, H., Lopez, R. & other authors (2005). The Universal Protein Resource (UniProt). Nucleic Acids Res 33, D154–D159.
Brzostowicz, P. C., Reams, A. B., Clark, T. J. & Neidle, E. L. (2003). Transcriptional cross-regulation of the catechol and protocatechuate branches of the β-ketoadipate pathway contributes to carbon source-dependent expression of the Acinetobacter sp. strain ADP1 pobA gene. Appl Environ Microbiol 69, 1598–1606.
Carey, J. (1991). Gel retardation. Methods Enzymol 208, 103–117.[Medline]
Crooks, G. E., Hon, G., Chandonia, J. M. & Brenner, S. E. (2004). WebLogo: a sequence logo generator. Genome Res 14, 1188–1190.
Dal, S., Steiner, I. & Gerischer, U. (2002). Multiple operons connected with catabolism of aromatic compounds in Acinetobacter sp. strain ADP1 are under carbon catabolite repression. J Mol Microbiol Biotechnol 4, 389–404.[Medline]
Dal, S., Trautwein, G. & Gerischer, U. (2005). Transcriptional organization of genes for protocatechuate and quinate degradation from Acinetobacter sp. strain ADP1. Appl Environ Microbiol 71, 1025–1034.
Freede, P. & Brantl, S. (2004). Transcriptional repressor CopR: use of SELEX to study the copR operator indicates that evolution was directed at maximal binding affinity. J Bacteriol 186, 6254–6264.
Freemont, P. S., Lane, A. N. & Sanderson, M. R. (1991). Structural aspects of protein–DNA recognition. Biochem J 278, 1–23.[Medline]
Gerischer, U., Segura, A. & Ornston, L. N. (1998). PcaU, a transcriptional activator of genes for protocatechuate utilization in Acinetobacter. J Bacteriol 180, 1512–1524.
Gerischer, U., Jerg, B. & Fischer, R. (2008). Spotlight on the Acinetobacter baylyi β-ketoadipate pathway: multiple levels of regulation. In Acinetobacter Molecular Biology, pp. 203–230. Edited by U. Gerischer. Norfolk, UK: Caister Scientific Press.
Grodberg, J. & Dunn, J. J. (1988). ompT encodes the Escherichia coli outer membrane protease that cleaves T7 RNA polymerase during purification. J Bacteriol 170, 1245–1253.
Halford, S. E. & Marko, J. F. (2004). How do site-specific DNA-binding proteins find their targets? Nucleic Acids Res 32, 3040–3052.
Hanahan, D. (1983). Studies on transformation of Escherichia coli with plasmids. J Mol Biol 166, 557–580.[Medline]
Harwood, C. S. & Parales, R. E. (1996). The β-ketoadipate pathway and the biology of self-identity. Annu Rev Microbiol 50, 553–590.[CrossRef][Medline]
Juni, E. & Janik, A. (1969). Transformation of Acinetobacter calco-aceticus (Bacterium anitratum). J Bacteriol 98, 281–288.
Kanack, K. J., Runyen-Janecky, L. J., Ferrell, E. P., Suh, S. J. & West, S. E. (2006). Characterization of DNA-binding specificity and analysis of binding sites of the Pseudomonas aeruginosa global regulator, Vfr, a homologue of the Escherichia coli cAMP receptor protein. Microbiology 152, 3485–3496.
Kolb, A., Busby, S., Buc, H., Garges, S. & Adhya, S. (1993). Transcriptional regulation by cAMP and its receptor protein. Annu Rev Biochem 62, 749–795.[CrossRef][Medline]
Krell, T., Molina-Henares, A. J. & Ramos, J. L. (2006). The IclR family of transcriptional activators and repressors can be defined by a single profile. Protein Sci 15, 1207–1213.[CrossRef][Medline]
Molina-Henares, A. J., Krell, T., Eugenia Guazzaroni, M., Segura, A. & Ramos, J. L. (2006). Members of the IclR family of bacterial transcriptional regulators function as activators and/or repressors. FEMS Microbiol Rev 30, 157–186.[CrossRef][Medline]
Mulder, N. J., Apweiler, R., Attwood, T. K., Bairoch, A., Bateman, A., Binns, D., Bradley, P., Bork, P., Bucher, P. & other authors (2005). InterPro, progress and status in 2005. Nucleic Acids Res 33, D201–D205.
Pan, B., Unnikrishnan, I. & LaPorte, D. C. (1996). The binding site of the IclR repressor protein overlaps the promoter of aceBAK. J Bacteriol 178, 3982–3984.
Popp, R., Kohl, T., Patz, P., Trautwein, G. & Gerischer, U. (2002). Differential DNA binding of transcriptional regulator PcaU from Acinetobacter sp. strain ADP1. J Bacteriol 184, 1988–1997.
Prentki, P. & Krisch, H. M. (1984). In vitro insertional mutagenesis with a selectable DNA fragment. Gene 29, 303–313.[CrossRef][Medline]
Sambrook, J. & Russell, D. (2001). Molecular Cloning: a Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Siehler, S. Y., Dal, S., Fischer, R., Patz, P. & Gerischer, U. (2007). Multiple-level regulation of genes for protocatechuate degradation in Acinetobacter baylyi includes cross-regulation. Appl Environ Microbiol 73, 232–242.
Studier, F. W., Rosenberg, A. H., Dunn, J. J. & Dubendorff, J. W. (1990). Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol 185, 60–89.[Medline]
Trautwein, G. & Gerischer, U. (2001). Effects exerted by transcriptional regulator PcaU from Acinetobacter sp. strain ADP1. J Bacteriol 183, 873–881.
Tropel, D. & van der Meer, J. R. (2004). Bacterial transcriptional regulators for degradation pathways of aromatic compounds. Microbiol Mol Biol Rev 68, 474–500.
Vaneechoutte, M., Young, D. M., Ornston, L. N., De Baere, T., Nemec, A., Van Der Reijden, T., Carr, E., Tjernberg, I. & Dijkshoorn, L. (2006). Naturally transformable Acinetobacter sp. strain ADP1 belongs to the newly described species Acinetobacter baylyi. Appl Environ Microbiol 72, 932–936.
Walker, J. R., Altamentova, S., Ezersky, A., Lorca, G., Skarina, T., Kudritska, M., Ball, L. J., Bochkarev, A. & Savchenko, A. (2006). Structural and biochemical study of effector molecule recognition by the E. coli glyoxylate and allantoin utilization regulatory protein AllR. J Mol Biol 358, 810–828.[CrossRef][Medline]
Zhang, R. G., Kim, Y., Skarina, T., Beasley, S., Laskowski, R., Arrowsmith, C., Edwards, A., Joachimiak, A. & Savchenko, A. (2002). Crystal structure of Thermotoga maritima 0065, a member of the IclR transcriptional factor family. J Biol Chem 277, 19183–19190.
Received 24 September 2007;
revised 13 December 2007;
accepted 14 December 2007.
This article has been cited by other articles:
|
|
 |
|
  T. Zimmermann, T. Sorg, S. Y. Siehler, and U. Gerischer Role of Acinetobacter baylyi Crc in Catabolite Repression of Enzymes for Aromatic Compound Catabolism J. Bacteriol., April 15, 2009; 191(8): 2834 - 2842. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Fillet, M. Velez, D. Lu, X. Zhang, M.-T. Gallegos, and J. L. Ramos TtgV Represses Two Different Promoters by Recognizing Different Sequences J. Bacteriol., March 15, 2009; 191(6): 1901 - 1909. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |
Repression by PcaU; the ratio between the uninduced expression in the respective strain and the uninduced expression in the derivative without a functional PcaU (growth on lactate in both cases). Kd, dissociation constant describing the affinity of PcaU for these binding sites. The positions indicated by the open arrows displayed a low mutation frequency in the ON1 control group and therefore are not considered. (b) Graphical representation of sequence conservation within the PcaU binding site created by WebLogo (Crooks et al., 2004
