|
|
||||||||
1 Department of Biological Sciences, Auburn University, AL 36849, USA
2 Department of Microbiology and Infectious Diseases, University of Calgary Health Sciences Centre, Calgary, AB T2N 4N1, Canada
Correspondence
Laura Silo-Suh
suhlaur{at}auburn.edu
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Typical P. aeruginosa isolates from the environment that infect CF patients produce numerous virulence determinants that contribute to establishing infections in animal model systems (Cox, 1982
; Meyer et al., 1996
; Nicas & Iglewski, 1985
; Ostroff et al., 1989b
; Wilderman et al., 2001
). However, P. aeruginosa recovered from the lungs of chronically infected CF patients typically lack some of these virulence determinants, suggesting that these products are dispensable for long-term maintenance of P. aeruginosa in vivo (Dacheux et al., 2001
; Luzar & Montie, 1985
; Smith et al., 2006
; Woods et al., 1986
). Conversely, P. aeruginosa gains an additional virulence determinant by overproducing the exopolysaccharide alginate within the CF lung. Alginate appears to form a protective barrier around the bacterium and limits exposure to oxidative radicals, antibiotics, opsonizing antibodies and phagocytes (Hatch & Schiller, 1998
; Oliver & Weir, 1985
; Pedersen et al., 1990
; Simpson et al., 1989
). In addition, P. aeruginosa forms microcolonies encapsulated in alginate and mucus within the CF lung (Worlitzsch et al., 2002
). This biofilm mode of growth limits the access of various immune molecules and antibiotics to the bacterium. Biofilm growth may also aid colonization by promoting genetic diversity within the bacterial population (Ehrlich et al., 2005
) and by allowing a subset of bacteria to exist in a reduced metabolic state and/or exist under anaerobic conditions, both of which can provide protection from elements of the immune system and antibiotics (Fux et al., 2005
).
It is becoming increasingly clear that microbial pathogens use different sets of virulence determinants and strategies for maintaining chronic infections versus establishing acute infections (Costerton et al., 2003
; Hong et al., 2000
; Young et al., 2002
). Both Mycobacterium tuberculosis and P. aeruginosa can establish decade-long infections in the lungs of humans and these pathogens appear to utilize similar strategies. For example, M. tuberculosis resides in granulomas during chronic lung infections, where it appears to exist in a reduced metabolic state under anaerobic conditions (Young et al., 2002
), similar to the existence of P. aeruginosa in biofilms in the CF lung. In addition, both P. aeruginosa and M. tuberculosis appear to alter their carbon metabolic activities while in the human lung (Honer zu Bentrup & Russell, 2001
; Silo-Suh et al., 2005
). Identification of additional virulence determinants that are active in P. aeruginosa within the CF lung and characterization of the role they play in pathogenesis or survival may provide strategies for treating these and other chronic infections.
To identify chronic virulence determinants, several research groups rely upon chronic animal model systems of infection (Fang et al., 2005
; McKinney et al., 2000
). We suggest that an alternative approach is to study bacterial isolates that have adapted to a chronic infection lifestyle, such as P. aeruginosa isolates adapted to the CF lung. Some of these adaptations manifest in P. aeruginosa under laboratory conditions because of DNA alterations induced by and selected within the CF lung. Likewise, those virulence determinants that no longer provide an advantage, such as some acute virulence determinants, appear to be readily lost as P. aeruginosa adapts to the CF lung. Therefore, the virulence determinants that are maintained, acquired or altered in P. aeruginosa following adaptation to the CF lung are potential chronic virulence determinants.
We previously determined that FRD1, a typical P. aeruginosa CF isolate, uses novel infection mechanisms compared to the wound isolate PAO1 to infect alfalfa seedlings (Silo-Suh et al., 2002
). We suggest that some of the novel virulence mechanisms employed by FRD1 to infect alfalfa may be the same mechanisms it relies upon to persist within the CF lung.
| METHODS |
|---|
|
|
|---|
|
Alfalfa seedling infection assay.
Approximately 1700 independent FRD1 transposon insertion mutants were screened for virulence in the alfalfa seedling infection assay. Seeds of alfalfa variety 57Q77, a wild-type strain not bred for pest resistance, were provided by Pioneer Hi-Bred International. The alfalfa assay was conducted as previously described (Silo-Suh et al., 2002
) with the following modifications: FRD1 and derivatives were inoculated onto wounded alfalfa seedlings using
105 c.f.u. per seedling while PAO1 and derivatives were inoculated using
104 c.f.u. per seedling. Water agar plates containing inoculated seedlings were sealed with Parafilm and placed in a 30 °C incubator without light. Disease symptoms were scored 6–7 days following inoculation by visual inspection. Seedlings with maceration symptoms were scored positive for infection. Each transposon insertion mutant was initially screened with 10 alfalfa seedlings. Putative mutants that were reduced for virulence on alfalfa by twofold or more compared to the parental strain were rescreened in subsequent rounds of 20 and 40 seedlings. PAO1 and PAO1aceA were inoculated on 60 seedlings for each experiment. Data were expressed as the mean±standard deviation and analysed for significance using an ANOVA (InStat; Graph Pad Software). A value of P<0.05 was considered significant.
DNA manipulations, transformations and conjugations.
E. coli strain DH10B was routinely used as a host strain for cloning. DNA was introduced into E. coli by electroporation and into P. aeruginosa by conjugation as previously described (Suh et al., 1999
). Plasmids were purified with QIAprep Spin Miniprep columns (Qiagen). DNA fragments were excised from agarose gels and purified using the Qiaex II DNA gel extraction kit (Qiagen) according to the manufacturer's instructions. Restriction enzymes and DNA modification enzymes were purchased from New England Biolabs. Either Pfu from Stratagene or Taq from New England Biolabs was used for PCR amplification of DNA. Oligonucleotides were purchased from Integrated DNA Technologies.
Southern blot analysis.
Genomic DNA was extracted from FRD1 and derivatives using the Wizard Genomic Extraction kit (Promega), digested with the appropriate restriction enzymes and electrophoretically separated on a 1 % agarose gel. The DNA was transferred to Hybond-N+ membrane (Amersham Pharmacia Biotech) via capillary blotting and fixed by baking for 2 h at 80 °C. The blot was probed with a 800 bp DNA fragment corresponding to the gentamicin resistance gene, which was biotinylated using the Psoralen-biotin kit (Ambion). Detection of the probe was performed using the BrightStar BioDetect kit (Ambion).
Identification of transposon insertion sites.
Genomic DNA was prepared from each of the transposon insertion mutants using Wizard Genomic (Promega), digested with the appropriate enzymes, cloned into pBluescript K(+) and electroporated into E. coli DH10B. The gentamicin-resistant colonies recovered from the transformation were verified for the presence of transposon sequences by PCR and then sequenced using primer LSP368 (cgagcgcgtcaattcgagggc). The plasmids containing cloned transposon and flanking P. aeruginosa sequences were sequenced by the Auburn University Research and Instrumentation Facility.
Growth competition.
FRD1 and FRD1 pqsE were inoculated into 12 ml fresh L-broth using 20 µl of an overnight culture. The mixed culture was sampled for c.f.u. on L-agar and L-agar plates containing gentamicin periodically over 24 h.
Construction of P. aeruginosa aceA and phzS mutants.
To generate aceA mutants of P. aeruginosa, the suicide plasmid pLS1536 was constructed: a DNA sequence containing
400 bp upstream and 430 bp downstream of the aceA coding sequence was PCR amplified from FRD1 cells with Pfu and cloned into the SmaI site of pBluescript K(+). The resulting plasmid was digested with SphI and the internal 1.3 kb fragment of the aceA coding sequence was removed and replaced with the aacC1 gene encoding gentamicin resistance as a SmaI fragment (Schweizer, 1993
). This was followed by introduction of an origin of transfer (moriT) of RP4 on a
230 bp HindIII fragment (Suh et al., 2004
). pLS1536 was introduced into P. aeruginosa strains FRD1 and PAO1 by triparental mating, and potential aceA mutants were isolated as gentamicin-resistant carbenicillin-sensitive clones, indicating a double crossover event. Replacement of the wild-type aceA gene with the aceA101 : : aacC1 allele was verified by PCR analysis.
To construct P. aeruginosa phzS mutants, the phzS coding sequence along with
345 bp upstream and 150 bp downstream sequences was PCR amplified from FRD1 cells with Pfu and cloned into the SmaI site of pBluescript K(+). An aacC1 gene carried on a SmaI fragment was cloned into the unique ScaI site internal to the phzS coding sequence and then oriT was added as an
230 bp HindIII fragment. The resulting plasmid, pLS1552, was conjugated into strain FRD1 as described above and potential mutant alleles were isolated as gentamicin-resistant carbenicillin-sensitive clones. Replacement of the wild-type phzS gene with the phzS101 : : aacC1 allele was verified by PCR.
Construction of aceA transcriptional fusion and complemented strains.
To construct the aceA : : lacZ transcriptional fusion, the PCR fragment containing the aceA gene from FRD1 described above was digested with EcoRV and cloned into the SmaI site of pSS223 (Suh et al., 2004
). The construct containing the aceA promoter and the 5' coding sequence in the proper orientation was verified by PCR and restriction digest before it was conjugated into P. aeruginosa.
To complement the aceA mutation in cis, aceA was PCR amplified from FRD1 with Pfu and cloned into pBluescript K(+) as a 2.07 kb EcoRI–SmaI fragment. The resulting plasmid, pJH109, was converted to a mobilizable plasmid, pJH122, by the addition of moriT to the HindIII site. pJH122 was introduced into P. aeruginosa via triparental mating. The complemented FRD1aceA and PAO1aceA mutants were designated FRD1aceA+ (JH168) and PAO1aceA+ (JH166) respectively.
Biochemical assays.
Alginate was isolated from P. aeruginosa culture supernatants that were dialysed against distilled water as previously described (Suh et al., 1999
), and the alginate level (i.e. uronic acid) was quantified by the carbazole method (Knutson & Jeanes, 1968
) using Macrocystis pyrifera alginate (Sigma-Aldrich) as a standard. Pyocyanin was purified and measured from 20 h cultures as described by Essar et al. (1990)
. Degradation of p-nitrophenylphosphorylcholine was used to measure phospholipase C activity as previously described, using 1 mg protein from filtered supernatant (Suh et al., 1999
). Phospholipase C activity was measured as the increase in A405 min–1 (mg protein)–1. Elastase and pyoverdine were measured as previously described (Suh et al., 1999
). β-Galactosidase assays were performed as described by Miller (1972)
. Isocitrate lyase (ICL) was measured according to the Sigma protocol EC 4.1.3.1 with minor modifications. P. aeruginosa cells were harvested from stationary cultures, resuspended in TE pH 6.8 and sonicated. Following centrifugation, the quantity of total proteins in the cell-free extracts was determined by the Bradford method (Bio-Rad). Each assay was conducted with 50 µg protein in a final volume of 1 ml.
Biofilm growth.
Measurement of static biofilm activity was performed as described by Head & Yu (2004)
. Briefly, P. aeruginosa was grown overnight in L-broth, diluted and adjusted to OD600
0.5, from which 5 µl was inoculated into 125 µl fresh L-broth in a 96-well microtitre plate. The plate was incubated overnight at 37 °C for 15 h prior to staining with crystal violet and optical density readings.
Rat chronic lung infections.
P. aeruginosa strains were tested for their ability to cause respiratory infections in the agar bead model in rats as described by Cash et al. (1979)
. For each P. aeruginosa strain tested, eight male Sprague–Dawley rats weighing 200–220 g (Charles River Breeding Laboratories) were tracheostomized under anaesthesia and inoculated with
104 c.f.u. bacteria embedded in agar beads. On day 14 post-infection, the lungs were aseptically removed. For each set of strains tested, lungs from four animals were homogenized in PBS (Polytron homogenizer, Brinkmann Instruments) and serial dilutions were plated onto trypticase soy agar to determine bacterial counts. The remaining lungs were fixed in 10 % formalin and examined for quantitative histopathological changes as previously described (Bernier et al., 2003
). The lung sections were scanned using an Epson 1650 scanner. Areas of inflammation, characterized by cellular infiltration, were identified and digitized with Scion Image software and reported as the percentage of the total area of the lung section that was covered by inflammatory exudates.
| RESULTS |
|---|
|
|
|---|
1 %, indicating random insertion of the mini-Tn5 in FRD1. The non-mucoid and auxotrophic mutants were discarded. Non-mucoid mutants were likely to contain transposon insertions in the alginate biosynthetic operon or in algT, which encodes the alternative sigma factor, sigma-22. Both classes of non-mucoid mutants have previously been tested for virulence in the alfalfa assay (Silo-Suh et al., 2002
Of
1700 FRD1 transposon insertion mutants screened in the alfalfa assay, 53 exhibited reduced virulence on alfalfa seedlings. The 21 mutants most severely affected for virulence on alfalfa seedlings were characterized for this investigation (Table 2
). With the exception of the FRD1 pqsB mutant, all mutants showed a more than twofold reduction in virulence on alfalfa compared to the parental strain. In addition, none of the mutants showed a growth defect in minimal medium with succinate as the carbon source compared to FRD1 (data not shown).
|
The second group of mutants is represented by insertions in seven different genes, all of which potentially play a role in carbon metabolism (Fig. 1
). ICL (PA2634), encoded by aceA, is specific to the glyoxylate shunt pathway and allows a variety of organisms to grow on fatty acids or acetate as a sole carbon source. PA0794 encodes an uncharacterized aconitate hydratase that may substitute for AcnA or AcnB in the tricarboxylic acid (TCA) pathway or may function in propionate metabolism as suggested by Grimek & Escalante-Semerena (2004)
. L-Asparaginase I (PA2253) converts asparagine into aspartate, which is one step away from conversion to oxaloacetate. PA3588 encodes OpdR, a porin of the OpdK subfamily, and is proposed to be involved in transport of phenylacetate, a short-chain fatty acid (Tamber et al., 2006
). PA1066 is predicted to encode a short-chain alcohol dehydrogenase involved in fatty acid β-oxidation. The gene nuoA (PA2637) encodes chain A of the proton-pumping NADH dehydrogenase I. Mutations in the nuo operon in E. coli inhibit citrate synthase and malate dehydrogenase of the TCA cycle (Pruss et al., 1994
). PA4466 encodes a gene with homology to npr, postulated to link carbon and nitrogen assimilation in E. coli (Powell et al., 1995
). Most of the genes in this group affect other cellular functions, including roles in nitrogen metabolism (ansA and npr) and iron homeostasis (npr and aconitase). Further testing will distinguish which of these functions are required for virulence of P. aeruginosa on alfalfa seedlings.
|
We first tested for elastase and pyocyanin production because these virulence determinants play a role in animal lung infection models (Blackwood et al., 1983
; Elsheikh et al., 1987
). Three of the 18 mutations that affected virulence of FRD1 on alfalfa also produced less elastase than FRD1 (Fig. 2a
), including the pqsE mutant as expected (P<0.001) (Coin et al., 1997
; Diggle et al., 2003
). Unexpectedly, neither the FRD1 pqsB nor pqsC mutants showed reduced elastase production, suggesting that the transposon insertions in these genes are not polar on the downstream pqsE gene. In addition, there appears to be a differential requirement for Pseudomonas quinolone signal (PQS) biosynthesis (pqsB and pqsC) versus response to PQS (pqsE) for elastase production.
|
Phospholipase C cleaves membrane phospholipids and is essential for P. aeruginosa virulence on a variety of host organisms (Berk et al., 1987
; Ostroff et al., 1989a
; Rahme et al., 1995
; Wiener-Kronish et al., 1993
). Given that several of the target mutants are possibly defective in fatty acid catabolism, we predicted a role for phospholipase C in liberating fatty acids for P. aeruginosa catabolism during infection. However, only one of the FRD1 targets, PA0428 (RNA helicase), in this study was defective for phospholipase C activity compared to the parental strain (Fig. 3a
). Verification of a role for phospholipases in the alfalfa assay will require the generation and testing of mutants that are specifically affected in phospholipase production.
|
Although all the targets selected for this study were visibly mucoid on solid media, we observed substantial differences in the viscosity of liquid-grown cultures, suggesting alterations in alginate production. As shown in Fig. 3(c)
, disruption of the PQS biosynthesis genes pqsB and pqsC reduced alginate production by FRD1, suggesting a relationship between quinolone signalling and alginate biosynthesis. Several genes not previously linked with alginate production were also identified here and include opdR, nuoA and aceA, all three of which are associated with carbon metabolism as indicated above.
FRD1 virulence mutants are defective for biofilm formation
P. aeruginosa is reported to form biofilms within the lungs of CF patients and this mode of growth likely facilitates persistence of the bacterium within this niche (Werner et al., 2004
; Worlitzsch et al., 2002
). Although CF isolates can be highly variable with respect to biofilm formation, strain FRD1 can form more robust biofilms than PAO1 under certain conditions (Lee et al., 2005
; O'Toole & Kolter, 1998
; Pham et al., 2004
). We observed increased biofilm formation by FRD1 compared to PAO1 using the biostatic biofilm assay developed by O'Toole & Kolter (1998)
. Disruptions in pqsE, PA0428 (RNA helicase), opdR, nuoA and sbcB resulted in poor biofilm formation by FRD1, while a disruption of pqsC enhanced biofilm formation (Fig. 4
). Several of the targets described here have not previously been associated with biofilm formation in P. aeruginosa and therefore may be specific for the ability of P. aeruginosa CF isolates to form biofilms.
|
|
|
|
| DISCUSSION |
|---|
|
|
|---|
In this study we identified genes required for FRD1, a CF isolate of P. aeruginosa, to infect alfalfa seedlings. On the basis of our earlier observations that FRD1 invokes novel strategies to infect alfalfa seedlings compared to the non-CF isolate PAO1, we believe some of these strategies to be important for the persistence of P. aeruginosa within the CF lung. Although our mutagenesis and screening strategy did not reach saturation of the P. aeruginosa genome, it does provide a glimpse of some of the virulence mechanisms functioning in FRD1. These include the glyoxylate pathway, biofilm activity and quorum sensing mediated by PQS.
We are especially intrigued by the large number of mutations affecting carbon metabolism because of the implications regarding P. aeruginosa's metabolism in the host and the potential avenues for therapeutic intervention. The requirement for ICL by FRD1 and PAO1 to infect alfalfa seedlings and by PAO1 to infect rat lungs indicates that the glyoxylate pathway plays an important role during P. aeruginosa pathogenesis. In a recent publication, lung surfactant lipids and amino acids were identified as carbon sources utilized by P. aeruginosa within the CF lung as indicated by high in vivo expression of the genes encoding catabolism or uptake of these compounds (Son et al., 2007
). While considerable data previously supported that peptides and amino acids fuelled the growth of P. aeruginosa within the CF lung (Barth & Pitt, 1996
; Palmer et al., 2005
), our study supports Son et al. (2007)
in that fatty acids are also important carbon sources for P. aeruginosa during chronic infection. The CF lung is rich in various fatty acids, some of which play important roles in lung function, including prostaglandins and phosphatidylcholine. Catabolism of such compounds might facilitate colonization of the CF lung by P. aeruginosa by impairing the functions of these compounds.
Also in agreement with Son et al. (2007)
, we report that aceA is more highly expressed in CF P. aeruginosa compared to non-CF isolates. However, our current data suggest that overexpression of aceA in FRD1 is due to aberrant regulation, most likely due to loss of a negative regulator. Consistent with this hypothesis is the observation that the FRD1 aceA gene complemented PAO1aceA to wild-type levels of ICL, suggesting that the FRD1 aceA gene is unaltered. Increased expression of aceA in FRD1 is a likely consequence of adaptation to the CF lung and, as such, expected to facilitate P. aeruginosa's ability to maintain infection within the CF lung. Our current studies raise the possibility of controlling P. aeruginosa infections within the CF lung with the use of drugs that inhibit ICL. The apparent absence of this enzyme in humans makes it an attractive therapeutic target.
Interestingly, several other genes we report here to be required for FRD1 virulence on alfalfa were shown to be either upregulated in P. aeruginosa within the CF lung, or constitutively expressed in P. aeruginosa CF isolates by Son et al. (2007)
. These genes include nuoA and PA4466 (npr). Therefore, the results of the alfalfa assay agrees with the conclusion of Son et al. (2007)
that some highly expressed genes within P. aeruginosa CF isolates play important roles during infection.
The second recognized grouping of mutants reduced for virulence on alfalfa seedlings was impaired in PQS biosynthesis and response. Because PQS positively regulates the production of several virulence determinants, including pyocyanin, rhamnolipid, elastase and PA-IL lectin in PAO1, we considered the possibility that the reduced virulence observed for this class of mutants is related to the loss of these standard virulence determinants (Diggle et al., 2003
). Not surprisingly, FRD1 was reduced for the production of elastase, phospholipase C and pyoverdine compared to the non-CF isolate PAO1. Loss or reduction of acute virulence determinants is a common feature in P. aeruginosa isolates adapted to the CF lung, which suggests that these products do not play a role in maintaining a chronic infection or are required in reduced quantities. Unexpectedly, disruptions in pqsB, pqsC and pqsE differentially affected several FRD1 phenotypes analysed in this report. The differential effects may be partially explained by the functions encoded by these genes. While PqsB and PqsC are predicted to play a role in synthesis of the quinolone, PqsE appears to be required for the cellular response to PQS (Diggle et al., 2006
). We are interested in this class of mutants because the PQS signalling system is suspected of facilitating adaptation of P. aeruginosa to the CF lung environment during early infection (Guina et al., 2003
). Furthermore, exogenously added PQS can affect P. aeruginosa biofilm development and PQS was recently demonstrated to regulate iron homeostasis and oxidative stress resistance in P. aeruginosa (Bredenbruch et al., 2006
; De Kievit et al., 2001
).
In addition to the two functional groupings of mutants recognized here, several of the mutants reduced for virulence on alfalfa have transposon insertions in genes that affect the envelope and outer-membrane properties of P. aeruginosa. These targets include two genes predicted to encode multidrug efflux proteins (PA3521 and PA4374) and PA0011, which is predicted to encode a lauroyl transferase with homology to HtrB. This protein functions in lipid A biosynthesis and is required for virulence by several human pathogens, including Haemophilus influenzae and Salmonella enterica serovar Typhimurium (DeMaria et al., 1997
; Jones et al., 1997
). Included in this group are the two mutants with transposon insertions in mdoH and mdoG, which encode membrane-derived oligosaccharides (MDOs). MDOs are branched substituted β-glucan chains present in the periplasm of various Gram-negative bacteria and their expression increases in low-osmolarity medium (Geiger et al., 1992
). The MDO mutants tend to suffer pleiotropic effects, most likely due to altered membrane properties, which may account for the requirement for MDOs by a variety of plant and animal pathogens for virulence (Bhagwat et al., 2004
; Page et al., 2001
). Loss of MDOs can impair growth in hypo-osmotic media, alter chemotaxis and motility, alter porin composition and increase sensitivity to biliary salts (Fiedler & Rotering, 1988
).
Six of the FRD1 transposon mutants reduced for virulence on alfalfa were affected in their ability to form static biofilms. Such a large grouping of mutants suggests a continuing role for biofilm formation, or maintenance, in chronic P. aeruginosa infections. Continued screening for chronic virulence determinants from CF isolates of P. aeruginosa will likely identify additional genes with important roles in persistence of this bacterium in eukaryotic hosts.
| ACKNOWLEDGEMENTS |
|---|
Edited by: M. S. Ullrich
| REFERENCES |
|---|
|
|
|---|
Berk, R. S., Brown, D., Coutinho, I. & Meyers, D. (1987). In vivo studies with two phospholipase C fractions from Pseudomonas aeruginosa. Infect Immun 55, 1728–1730.
Bernier, S. P., Silo-Suh, L., Woods, D. E., Ohman, D. E. & Sokol, P. A. (2003). Comparative analysis of plant and animal models for characterization of Burkholderia cepacia virulence. Infect Immun 71, 5306–5313.
Bhagwat, A., Gross, K., Smith, A. & Scott, A. (2004). Membrane-derived Oligosaccharides of Salmonella Serovar Typhimurium. Abstract, American Society for Microbiology Annual Meeting, p. 107.
Blackwood, L. L., Stone, R. M., Iglewski, B. H. & Pennington, J. E. (1983). Evaluation of Pseudomonas aeruginosa exotoxin A and elastase as virulence factors in acute lung infection. Infect Immun 39, 198–201.
Bredenbruch, F., Geffers, R., Nimtz, M., Buer, J. & Haussler, S. (2006). The Pseudomonas aeruginosa quinolone signal (PQS) has an iron-chelating activity. Environ Microbiol 8, 1318–1329.[CrossRef][Medline]
Cash, H. A., Woods, D. E., McCullough, B., Johanson, W. G. & Bass, J. A. (1979). A rat model of chronic respiratory infection with Pseudomonas aeruginosa. Am Rev Respir Dis 119, 453–459.[Medline]
Coin, D., Louis, D., Bernillon, J., Guinand, M. & Wallach, J. (1997). LasA, alkaline protease and elastase in clinical strains of Pseudomonas aeruginosa: quantification by immunochemical methods. FEMS Immunol Med Microbiol 18, 175–184.[Medline]
Costerton, W., Veeh, R., Shirtliff, M., Pasmore, M., Post, C. & Ehrlich, G. (2003). The application of biofilm science to the study and control of chronic bacterial infections. J Clin Invest 112, 1466–1477.[CrossRef][Medline]
Cox, C. D. (1982). Effect of pyochelin on the virulence of Pseudomonas aeruginosa. Infect Immun 36, 17–23.
Dacheux, D., Attree, I. & Toussaint, B. (2001). Expression of ExsA in trans confers type III secretion system-dependent cytotoxicity on noncytotoxic Pseudomonas aeruginosa cystic fibrosis isolates. Infect Immun 69, 538–542.
Davis, R. W., Botstein, D. & Roth, J. R. (1980). Advanced Bacterial Genetics. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
De Kievit, T. R., Gillis, R., Marx, S., Brown, C. & Iglewski, B. H. (2001). Quorum-sensing genes in Pseudomonas aeruginosa biofilms: their role and expression patterns. Appl Environ Microbiol 67, 1865–1873.
DeMaria, T. F., Apicella, M. A., Nichols, W. A. & Leake, E. R. (1997). Evaluation of the virulence of nontypeable Haemophilus influenzae lipooligosaccharide htrB and rfaD mutants in the chinchilla model of otitis media. Infect Immun 65, 4431–4435.[Abstract]
Diaz-Perez, A. L., Roman-Doval, C., Diaz-Perez, C., Cervantes, C., Sosa-Aquirre, C. R., Lopez-Meza, J. E. & Campos-Garcia, J. (2007). Identification of the aceA gene encoding isocitrate lyase required for the growth of Pseudomonas aeruginosa on acetate, acyclic terpenes and leucine. FEMS Microbiol Lett 269, 309–316.[CrossRef][Medline]
Diggle, S. P., Winzer, K., Chhabra, S. R., Worrall, K. E., Camara, M. & Williams, P. (2003). The Pseudomonas aeruginosa quinolone signal molecule overcomes the cell density-dependency of the quorum sensing hierarchy, regulates rhl-dependent genes at the onset of stationary phase and can be produced in the absence of LasR. Mol Microbiol 50, 29–43.[CrossRef][Medline]
Diggle, S. P., Cornelis, P., Williams, P. & Camara, M. (2006). 4-Quinolone signalling in Pseudomonas aeruginosa: old molecules, new perspectives. Int J Med Microbiol 296, 83–91.[CrossRef][Medline]
Ehrlich, G. D., Hu, F. Z., Shen, K., Stoodley, P. & Post, J. C. (2005). Bacterial plurality as a general mechanism driving persistence in chronic infections. Clin Orthop Relat Res 20–24.
Elsheikh, L. E., Kronevi, T., Wretlind, B., Abaas, S. & Iglewski, B. H. (1987). Assessment of elastase as a Pseudomonas aeruginosa virulence factor in experimental lung infection in mink. Vet Microbiol 13, 281–289.[CrossRef][Medline]
Essar, D. W., Eberly, L., Hadero, A. & Crawford, I. P. (1990). Identification and characterization of genes for a second anthranilate synthase in Pseudomonas aeruginosa: interchangeability of the two anthranilate synthases and evolutionary implications. J Bacteriol 172, 884–900.
Fang, F. C., Libby, S. J., Castor, M. E. & Fung, A. M. (2005). Isocitrate lyase (AceA) is required for Salmonella persistence but not for acute lethal infection in mice. Infect Immun 73, 2547–2549.
Fiedler, W. & Rotering, H. (1988). Properties of Escherichia coli mutants lacking membrane-derived oligosaccharides. J Biol Chem 263, 14684–14689.
Fux, C. A., Costerton, J. W., Stewart, P. S. & Stoodley, P. (2005). Survival strategies of infectious biofilms. Trends Microbiol 13, 34–40.[CrossRef][Medline]
Geiger, O., Russo, F. D., Silhavy, T. J. & Kennedy, E. P. (1992). Membrane-derived oligosaccharides affect porin osmoregulation only in media of low ionic strength. J Bacteriol 174, 1410–1413.
Grimek, T. L. & Escalante-Semerena, J. C. (2004). The acnD genes of Shewenella oneidensis and Vibrio cholerae encode a new Fe/S-dependent 2-methylcitrate dehydratase enzyme that requires prpF function in vivo. J Bacteriol 186, 454–462.
Guina, T., Purvine, S. O., Yi, E. C., Eng, J., Goodlett, D. R., Aebersold, R. & Miller, S. I. (2003). Quantitative proteomic analysis indicates increased synthesis of a quinolone by Pseudomonas aeruginosa isolates from cystic fibrosis airways. Proc Natl Acad Sci U S A 100, 2771–2776.
Hatch, R. A. & Schiller, N. L. (1998). Alginate lyase promotes diffusion of aminoglycosides through the extracellular polysaccharide of mucoid Pseudomonas aeruginosa. Antimicrob Agents Chemother 42, 974–977.
Head, N. E. & Yu, H. (2004). Cross-sectional analysis of clinical and environmental isolates of Pseudomonas aeruginosa: biofilm formation, virulence, and genome diversity. Infect Immun 72, 133–144.
Henry, R. L., Mellis, C. M. & Petrovic, L. (1992). Mucoid Pseudomonas aeruginosa is a marker of poor survival in cystic fibrosis. Pediatr Pulmonol 12, 158–161.[Medline]
Holloway, B. W., Krishnapillai, V. & Morgan, A. F. (1979). Chromosomal genetics of Pseudomonas. Microbiol Rev 43, 73–102.
Honer zu Bentrup, K. & Russell, D. G. (2001). Mycobacterial persistence: adaptation to a changing environment. Trends Microbiol 9, 597–605.[CrossRef][Medline]
Honer Zu Bentrup, K., Miczak, A., Swenson, D. L. & Russell, D. G. (1999). Characterization of activity and expression of isocitrate lyase in Mycobacterium avium and Mycobacterium tuberculosis. J Bacteriol 181, 7161–7167.
Hong, P. C., Tsolis, R. M. & Ficht, T. A. (2000). Identification of genes required for chronic persistence of Brucella abortus in mice. Infect Immun 68, 4102–4107.
Jones, B. D., Nichols, W. A., Gibson, B. W., Sunshine, M. G. & Apicella, M. A. (1997). Study of the role of the htrB gene in Salmonella typhimurium virulence. Infect Immun 65, 4778–4783.[Abstract]
Knutson, C. A. & Jeanes, A. (1968). A new modification of the carbazole analysis: application to heteropolysaccharides. Anal Biochem 24, 470–481.[CrossRef][Medline]
Lau, G. W., Ran, H., Kong, F., Hassett, D. J. & Mavrodi, D. (2004). Pseudomonas aeruginosa pyocyanin is critical for lung infection in mice. Infect Immun 72, 4275–4278.
Lee, B., Haagensen, A. J., Ciofu, O., Anderson, J. B., Hoiby, N. & Molin, S. (2005). Heterogeneity of biofilms formed by nonmucoid Pseudomonas aeruginosa isolates from patients with cystic fibrosis. J Clin Microbiol 43, 5247–5255.
Luzar, M. A. & Montie, T. C. (1985). Avirulence and altered physiological properties of cystic fibrosis strains of Pseudomonas aeruginosa. Infect Immun 50, 572–576.
Mahenthiralingam, E., Campbell, M. E., Foster, J., Lam, J. S. & Speert, D. P. (1996). Random amplified polymorphic DNA typing of Pseudomonas aeruginosa isolates recovered from patients with cystic fibrosis. J Clin Microbiol 34, 1129–1135.[Abstract]
McKinney, J. D., Honer zu Bentrup, K., Munoz-Elias, E. J., Miczak, A., Chen, B., Chan, W. T., Swenson, D., Sacchettini, J. C., Jacobs, W. R., Jr & Russell, D. G. (2000). Persistence of Mycobacterium tuberculosis in macrophages and mice requires the glyoxylate shunt enzyme isocitrate lyase. Nature 406, 735–738.[CrossRef][Medline]
Meyer, J. M., Neely, A., Stintzi, A., Georges, C. & Holder, I. A. (1996). Pyoverdin is essential for virulence of Pseudomonas aeruginosa. Infect Immun 64, 518–523.[Abstract]
Miller, J. H. (1972). Experiments in Molecular Genetics. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Nicas, T. I. & Iglewski, B. H. (1985). The contribution of exoproducts to virulence of Pseudomonas aeruginosa. Can J Microbiol 31, 387–392.[Medline]
O'Toole, G. A. & Kolter, R. (1998). Flagellar and twitching motility are necessary for Pseudomonas aeruginosa biofilm development. Mol Microbiol 30, 295–304.[CrossRef][Medline]
Ohman, D. E. & Chakrabarty, A. M. (1981). Genetic mapping of chromosomal determinants for the production of the exopolysaccharide alginate in a Pseudomonas aeruginosa cystic fibrosis isolate. Infect Immun 33, 142–148.
Oliver, A. M. & Weir, D. M. (1985). The effect of Pseudomonas alginate on rat alveolar macrophage phagocytosis and bacterial opsonization. Clin Exp Immunol 59, 190–196.[Medline]
Ostroff, R. M., Wretlind, B. & Vasil, M. L. (1989a). Mutations in the hemolytic-phospholipase C operon result in decreased virulence of Pseudomonas aeruginosa PAO1 grown under phosphate-limiting conditions. Infect Immun 57, 1369–1373.
Ostroff, R. M., Wretlind, B. & Vasil, M. L. (1989b). Mutations in the hemolytic-phospholipase C operon result in decreased virulence of Pseudomonas aeruginosa PAO1 grown under phosphate-limiting conditions. Infect Immun 57, 1369–1373.
Page, F., Altabe, S., Hugouvieux-Cotte-Pattat, N., Lacroix, J. M., Robert-Baudouy, J. & Bohin, J. P. (2001). Osmoregulated periplasmic glucan synthesis is required for Erwinia chrysanthemi pathogenicity. J Bacteriol 183, 3134–3141.
Palmer, K. L., Mashburn, L. M., Singh, P. K. & Whiteley, M. (2005). Cystic fibrosis sputum supports growth and cues key aspects of Pseudomonas aeruginosa physiology. J Bacteriol 187, 5267–5277.
Pedersen, S. S., Kharazmi, A., Espersen, F. & Hoiby, N. (1990). Pseudomonas aeruginosa alginate in cystic fibrosis sputum and the inflammatory response. Infect Immun 58, 3363–3368.
Pham, T. H., Webb, J. S. & Rehm, B. H. (2004). The role of polyhydroxyalkanoate biosynthesis by Pseudomonas aeruginosa in rhamnolipid and alginate production as well as stress tolerance and biofilm formation. Microbiology 150, 3405–3413.
Powell, B. S., Court, D. L., Inada, T., Nakamura, Y., Michotey, V., Cui, X., Reizer, A., Saier, M. H., Jr & Reizer, J. (1995). Novel proteins of the phosphotransferase system encoded within the rpoN operon of Escherichia coli. Enzyme IIANtr affects growth on organic nitrogen and the conditional lethality of an erats mutant. J Biol Chem 270, 4822–4839.
Pruss, B. M., Nelms, J. M., Park, C. & Wolfe, A. J. (1994). Mutations in NADH : ubiquinone oxidoreductase of Escherichia coli affect growth on mixed amino acids. J Bacteriol 176, 2143–2150.
Rahme, L. G., Stevens, E. J., Wolfort, S. F., Shao, J., Tompkins, R. G. & Ausubel, F. M. (1995). Common virulence factors for bacterial pathogenicity in plants and animals. Science 268, 1899–1902.
Schweizer, H. D. (1993). Small broad-host-range gentamicin resistance gene cassettes for site-specific insertion and deletion mutagenesis. Biotechniques 15, 831–833.[Medline]
Silo-Suh, L., Suh, S. J., Sokol, P. A. & Ohman, D. E. (2002). A simple alfalfa seedling infection model for Pseudomonas aeruginosa strains associated with cystic fibrosis shows AlgT (sigma-22) and RhlR contribute to pathogenesis. Proc Natl Acad Sci U S A 99, 15699–15704.
Silo-Suh, L., Suh, S. J., Phibbs, P. V. & Ohman, D. E. (2005). Adaptations of Pseudomonas aeruginosa to the cystic fibrosis lung environment can include deregulation of zwf, encoding glucose-6-phosphate dehydrogenase. J Bacteriol 187, 7561–7568.
Simpson, J. A., Smith, S. E. & Dean, R. T. (1989). Scavenging by alginate of free radicals released by macrophages. Free Radic Biol Med 6, 347–353.[CrossRef][Medline]
Smith, E. E., Buckley, D. G., Wu, Z., Saenphimmachak, C., Hoffman, L. R., D'Argenio, D. A., Miller, S. I., Ramsey, B. W., Speert, D. P. & other authors (2006). Genetic adaptation by Pseudomonas aeruginosa to the airways of cystic fibrosis patients. Proc Natl Acad Sci U S A 103, 8487–8492.
Son, M. S., Matthews, W. J., Jr, Kang, Y., Nguyen, D. T. & Hoang, T. T. (2007). In vivo evidence of Pseudomonas aeruginosa nutrient acquisition and pathogenesis in the lungs of cystic fibrosis patients. Infect Immun 75, 5313–5324.
Struelens, M. J., Schwam, V., Deplano, A. & Baran, D. (1993). Genome macrorestriction analysis of diversity and variability of Pseudomonas aeruginosa strains infecting cystic fibrosis patients. J Clin Microbiol 31, 2320–2326.
Suarez, A., Guttler, A., Stratz, M., Staendner, L. H., Timmis, K. N. & Guzman, C. A. (1997). Green fluorescent protein-based reporter systems for genetic analysis of bacteria including monocopy applications. Gene 196, 69–74.[CrossRef][Medline]
Suh, S. J., Silo-Suh, L., Woods, D. E., Hassett, D. J., West, S. E. & Ohman, D. E. (1999). Effect of rpoS mutation on the stress response and expression of virulence factors in Pseudomonas aeruginosa. J Bacteriol 181, 3890–3897.
Suh, S. J., Silo-Suh, L. & Ohman, D. E. (2004). Development of tools for the genetic manipulation of Pseudomonas aeruginosa. J Microbiol Methods 58, 203–212.[CrossRef][Medline]
Tamber, S., Ochs, M. M. & Hancock, R. E. (2006). Role of the novel OprD family of porins in nutrient uptake in Pseudomonas aeruginosa. J Bacteriol 188, 45–54.
Werner, E., Roe, F., Bugnicourt, A., Franklin, M. J., Heydorn, A., Molin, S., Pitts, B. & Stewart, P. S. (2004). Stratified growth in Pseudomonas aeruginosa biofilms. Appl Environ Microbiol 70, 6188–6196.
Wiener-Kronish, J. P., Sakuma, T., Kudoh, I., Pittet, J. F., Frank, D. W., Dobbs, L., Vasil, M. L. & Mattay, M. A. (1993). Alveolar epithelial injury and pleural empyema in acute P. aeruginosa pneumonia in anesthetized rabbits. J Appl Physiol 75, 1661–1669.
Wilderman, P. J., Vasil, A. I., Johnson, Z. & Vasil, M. L. (2001). Genetic and biochemical analyses of a eukaryotic-like phospholipase D of Pseudomonas aeruginosa suggest horizontal acquisition and a role for persistence in a chronic pulmonary infection model. Mol Microbiol 39, 291–303.[CrossRef][Medline]
Woods, D. E., Schaffer, M. S., Rabin, H. R., Campbell, G. D. & Sokol, P. A. (1986). Phenotypic comparison of Pseudomonas aeruginosa strains isolated from a variety of clinical sites. J Clin Microbiol 24, 260–264.
Worlitzsch, D., Tarran, R., Ulrich, M., Schwab, U., Cekici, A., Meyer, K. C., Birrer, P., Bellon, G., Berger, J. & other authors (2002). Effects of reduced mucus oxygen concentration in airway Pseudomonas infections of cystic fibrosis patients. J Clin Invest 109, 317–325.[CrossRef][Medline]
Young, D., Hussell, T. & Dougan, G. (2002). Chronic bacterial infections: living with unwanted guests. Nat Immunol 3, 1026–1032.[CrossRef][Medline]
Received 29 October 2007;
revised 29 January 2008;
accepted 3 March 2008.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |