|
|
||||||||
1 Department of Environmental Hydrology and Microbiology, Zuckerberg Institute for Water Research, J. Blaustein Institutes for Desert Research, Ben-Gurion University of the Negev, Sede-Boqer Campus, 84990 Midreshet Ben-Gurion, Israel
2 Department of Biology, University of Massachusetts Amherst, Amherst, MA 01003, USA
Correspondence
Osnat Gillor
gilloro{at}bgu.ac.il
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
The SOS response regulon has been studied extensively in E. coli (Kelley, 2006
; Little & Mount, 1982
; Walker, 1995
). The genes encoding SOS-induced proteins are regulated by the LexA and RecA proteins, which serve as repressor and activator, respectively. In gammaproteobacteria, LexA represses transcription by binding to a 16-mer consensus sequence (CTG-N10-CAG) called the LexA binding site or SOS box (Erill et al., 2003
). Individual SOS boxes vary in their DNA sequences and in their ability to bind the LexA protein (Walker, 1995
).
In vitro studies of the promoter region of colicins E1 (Ebina et al., 1983
), A (Lloubes et al., 1988
, 1993
) and K (Mrak et al., 2007
) reveal that LexA binds cooperatively to the SOS regulatory region. Site-directed mutagenesis of LexA binding sites reveals that the first operator (Table 1
, solid underline) is more pronounced in LexA binding affinity than the second (Table 1
, dotted underline) (Lloubes et al., 1993
). In vivo studies of the promoter region of colicins E1 (Salles & Weinstock, 1989
) and E7 (Lu & Chak, 1996
) show that mutations in either LexA binding motif result in an increased level of colicin production, suggesting that the colicin operon contains two distinct SOS boxes. In contrast, mutations within the SOS boxes of colicin K result in reduced expression (Mrak et al., 2007
).
|
| METHODS |
|---|
|
|
|---|
=1.000, bootstrap=10 000, pairwise deletion and all nucleotides included. MP: complete deletion, CNI level=1, bootstrap=1000. For the Bayesian analysis, default parameter settings were employed with the following exceptions. MrBayes: characters used=457, Jukes and Cantor model, gamma rates,
=1.000, number of generations=1 000 000, sample frequency=100, burnin=2500. The returned split frequency standard deviation after 1 000 000 generations was 0.006. The returned potential scale reduction factor (PSRF) was 1.000. The returned posterior probability (PP) values, a measurement for clade credibility, are presented in Fig. 1
|
Bacterial strains and plasmids.
Table 2
lists the strains and plasmids used in this study. Construction of pDEW201 (containing the promoterless luxCDABE) and pDEW238 (containing the E. coli recA promoter) has been reported elsewhere (Van Dyk & Rosson, 1998
; Van Dyk et al., 2001a
). The promoters of colicins E1 and Ib were PCR-amplified and cloned into the multiple cloning site of pDEW201 (Van Dyk & Rosson, 1998
). Plasmids were transformed into E. coli strains BZB1011 (Pugsley & Schwartz, 1983
), DM1180 (Mount, 1977
) and DM1187 (Kim & Little, 1992
). Colicin inserts were confirmed by DNA sequence determination.
|
Growth media and chemicals.
Luria–Bertani (LB) medium was used for all experiments and was supplemented at 100 mg l–1 ampicillin (Sigma). Seven concentrations (4, 2, 1, 0.5, 0.25, 0.125 and 0.0625 mg l–1) of mitomycin C (MitC; Sigma) were added to the media to induce the SOS response from a 1 g l–1 aqueous stock solution.
DNA manipulation.
The 259 bp ce1a promoter was cloned into pBlueScriptII SK(+) (Stratagene) and four primers containing the desired deletions were generated:
(1) 5063R 5' GCATAAAAGCTACGCCGCTGCATTTTC 3';
(2) 5078F 5' CAGTGGTTATATGTACAGTATTTATTT 3';
(3) 5078R 5' CTGGTTTTATATACAGCATAA 3';
(4) 5093F 5' GTATTTATTTTTAACTTATTG 3' (accession no. J01566).
The plasmid containing the intact ce1a promoter region was PCR-amplified using primers 1 and 2, 3 and 4, and 1 and 4, together with HotStarTaq DNA polymerase (Qiagen). The PCR products were treated with DpnI and T4 polynucleotide kinase (New England Biolabs), and were then religated using T4 DNA ligase (New England Biolabs). The resulting vectors were transformed into E. coli strain DH10B (Stratagene) and mutations were confirmed by sequencing. Mutated promoters, i.e. Pce1a (+/–), (–/+) and (–/–) (see Table 1
), were PCR-amplified, subcloned into pDEW201, and electroporated into the E. coli strains.
Reporter assay.
Bacteria were grown overnight in LB supplemented with ampicillin. The cultures were diluted in LB (1 : 100) and grown to a density of
2x108 cells ml–1. A twofold dilution series of MitC was added to 96-well microtitre plates (Nunc) and equal volumes of cells were added. The plates were incubated in a temperature-controlled luminometer (Dynatech ML300). All experiments were run in duplicate and were repeated at least three times. Luminescence values are presented as arbitrary relative light units (RLU), or as the ratio of the luminescence of the induced sample to that of the uninduced control (response ratio), as described elsewhere (Van Dyk et al., 2001a
).
| RESULTS |
|---|
|
|
|---|
70 promoter region (identified as –35 and –10 boxes), one or two LexA binding sites, a thymine (T)-rich region and a Shine–Dalgarno (SD) box (Riley et al., 2001
The first motif was found in 15 bacteriocin gene clusters and is unique in possessing an A-rich region between the –35 and –10 boxes (
10 bp), double LexA binding sites, a relatively long (
18 bp) T-rich region, and an additional short (
7 bp) highly conserved T-rich region (not shown). Bacteriocins with this motif can be divided into five subgroups: 1a=colicins E2, E3, E6 and Hu; 1b=colicins E1, N, B and Y; 1c=colicins 5, 10, S4 and K; 1d=colicin Js and pesticin (produced by Yersinia pestis); and 1e=colicin D. Two additional bacteriocins, cloacin DF13 and marcesin A, although possessing a similar motif, contain a single LexA binding site.
Alveocins A and B (produced by Hafnia alvei) and klebicin C (produced by Klebsiella pneumoniae) share the presence of double overlapping LexA binding sites and a variable T-rich region, but lack the short consensus T-rich region. Colicins Ia and Ib possess a single LexA binding site, which differs from the E. coli consensus sequence (Table 3
), and have relatively short conserved T-rich regions. Klebicins C and D (both produced by Klebsiella oxytoca) have a single SOS box, similar in sequence to that found in E. coli, but lacking the T-rich regions. Colicin A and klebicin B (produced by K. pneumoniae) share an insertion of about 60 bp located between dual LexA binding sites and the SD box (Riley et al., 2001
), and lack the T-rich region.
|
|
Induction patterns of colicin E1 and Ib promoters
The colicin E1 (Pce1a) and Ib (Pciba) promoters were chosen as representatives of the dual and single LexA motifs, respectively. These promoter regions were inserted upstream of the Photorhabdus luminescens luxCDABE reporter genes (Table 2
) and electroporated into E. coli strain BZB1011 (Pugsley, 1985
). The impact on transcription levels of seven MitC concentrations was tested (Fig. 3a
). The greatest effect was observed with addition of 2 and 4 mg MitC l–1 for both Pce1a and Pciba; however, the Pce1a response ratios were always higher (Fig. 3b
). When assayed without inducing agent (Fig. 3b
), Pce1a had a
45-fold increase in light emission within 3 h (ranging from 0.1±0.06 to 4.5±0.12 RLU), while the Pciba construct showed almost no increase over the same time period (ranging from 0.2±0.03 to 0.4±0.07 RLU). The Pciba induction peak was
20-fold lower than that of Pce1a (335.8±30.6 compared to 16.2±4.3 RLU, respectively).
|
80, followed by a decline in expression until a plateau is reached in 3 h. Pcib has a similar initial lag phase, followed by a much slower increase until a maximum response ratio of
50 is reached after 5 h. These observations indicate differences in regulation and promoter strength under inducing (Fig. 3c
The dual LexA binding sites of the colicin E1 promoter
To assess the relative contributions of the dual SOS boxes in the ce1a promoter, three constructs with alternative LexA sequences were created (Table 2
) and expressed in two E. coli strains containing mutant LexA genes (Table 2
). The mutants had their first (–/+), second (+/–) or both (–/–) SOS boxes deleted (Table 2
). Plasmids carrying these mutants were introduced into strain DM1180 (Mount, 1977
), which encodes a non-cleavable LexA protein, resulting in complete repression of the SOS-regulated genes. Strain DM1180 served as a positive control, as light emission should be negatively proportional to the LexA repression. The second mutant host, strain DM1187 (Kim & Little, 1992
), served as a negative control, as it encodes a LexA protein unable to bind to the operator, resulting in unregulated expression of the SOS-regulated genes. There should be no difference in light emission between the wild-type and mutated Pce1a constructs carried by this strain.
Levels of uninduced expression of the wild-type Pce1a in strains DM1180 and DM1187 (Table 4
) differed by 99.8 %. In contrast, levels of expression of the two single (+/–, –/+) and double (–/–) mutants differed by 90.2, 36.3 and 8.6 %, respectively. These results suggest that LexA proteins bind most tightly to a promoter which contains the dual SOS box (+/+), less tightly to a promoter with a single LexA binding site (+/– and –/+ mutants), and not at all to a promoter that lacks an SOS box (–/–). Furthermore, the expression levels of the single box (–/+) promoter carried by strain DM1187 were approximately half of those measured for the wild-type promoter (+/+), the alternative single (+/–), and the double (–/–) mutants.
|
|
| DISCUSSION |
|---|
|
|
|---|
The majority of enteric bacteriocins possess dual LexA binding sites; however, these sites deviate considerably from the E. coli SOS box consensus (Fernandez De Henestrosa et al., 2000
; Lewis et al., 1994
). The bacteriocin dual SOS boxes consist of a highly conserved A tract (Fig. 2
) found at the distal and proximal LexA binding sites (Table 3
). DNA molecules containing four to six consecutive A or T base pairs are predicted to have an intrinsic structural curvature that can impact their role in transcriptional activation by affecting promoter geometry (Barbic et al., 2003
; Perez-Martin & de Lorenzo, 1997
). Although increases in promoter strength due to DNA bending are usually associated with sequences upstream of the promoter region (Perez-Martin & de Lorenzo, 1997
), it has been shown that bent DNA at or near the transcriptional start site is an important component of T7 RNA polymerase promoter enhancement, suggesting that in order to affect promoter activation, bent DNA should be situated in close proximity to the transcription initiation site (Ujvari & Martin, 2000
).
In the case of bacteriocin promoters, this bend is predicted to occur 12 bp downstream of the –10 box. It is thus possible that changes observed in promoter strength (Table 4
) are due to intrinsically bent or bendable DNA within the LexA binding sites (Perez-Martin & de Lorenzo, 1997
). The highest bioluminescence levels (Table 4
), in a background of DM1187 (producing a mutated LexA protein that is unable to bind to its site), were measured in Pce1a wild-type (+/+) and the single-site mutant (+/–), where the A tract is located in a 3' position to the Pribnow box (Table 1
). However, in the alternative single mutant (–/+), the A tract is not present and the TA sequence forms a rigid structure. This observation may explain the decreased levels of luminescence measured and is supported by Mrak and colleagues (Mrak et al., 2007
), who showed that T substitutions in the A tract of the distal SOS box (the AAAA motif was altered to ATAT) result in a decrease in gene expression, signifying the importance of the A motif. Interestingly, the single SOS box found in the colicin Ib promoter lacks A or T tracts (Table 3
), and is thus less bendable, which might explain the lower response ratio observed (Fig. 3
).
Expression levels induced by the distal site are more pronounced than those of the proximal site in the colicin K promoter (Mrak et al., 2007
). Additionally, the dual promoter sites of colicin E7, which both have an A tract (Table 3
), show similar expression levels (Lu & Chak, 1996
). Colicins K and E1 have the A tract located at the proximal SOS box only (Table 3
). Moreover, SOS-regulated genes, such as dinB, yebF and yigN, containing an A or T tract fused upstream to the luxCDABE reporter operon, have a higher response ratio compared to promoters carrying the consensus AT tract, such as recA, uvrA and uvrD (Fernandez De Henestrosa et al., 2000
; Van Dyk et al., 2001b
). Our analysis indicates that the structure of the LexA binding sites enhances the expression of the downstream genes, and in theory occurs in conjunction with a
70 box forming a strong promoter.
A comparison of response rates between Pce1a and Pciba reveals that the ce1a promoter induces a more rapid and higher level of gene expression compared to the ciba promoter (Fig. 3
). Promoter–reporter gene fusions using gfp downstream of colicin D (Norman et al., 2005
) and K (Mrak et al., 2007
) promoters have been shown to respond in a similar manner, with high expression/leakage ratios and rapid responses to environmental stimuli. One hypothesis to explain these observations is that bacteriocin toxins are lethal to the producing cells and have intrinsically strong promoters. Therefore, it is vital for the cell to keep bacteriocin production under tight control; once expression is initiated it leads to cell death (Mulec et al., 2003
). The highly conserved region downstream of the
70 box compared to the upstream sequence (data not shown) in most of the colicin promoters suggests that the LexA binding sites play a major role in enhancing promoter strength and control. These sites, frequently found in the promoters of enteric bacteriocins, result in both an increase in repressor binding strength and the ability to upregulate expression. The evolution of this dual binding site system elegantly accomplishes the task of increasing toxin production when induced, without a proportional increase in leakage when repressed. This effectively reduces the cost of colicin production, and may explain how such a seemingly costly defence system is maintained at such high frequencies in enteric bacteria (Gordon & O'Brien, 2006
).
| ACKNOWLEDGEMENTS |
|---|
Edited by: D. M. Gordon
| REFERENCES |
|---|
|
|
|---|
Braun, V., Pilsl, H. & Gross, P. (1994). Colicins: structures, modes of action, transfer through membranes, and evolution. Arch Microbiol 161, 199–206.[Medline]
Cascales, E., Buchanan, S. K., Duche, D., Kleanthous, C., Lloubes, R., Postle, K., Riley, M., Slatin, S. & Cavard, D. (2007). Colicin biology. Microbiol Mol Biol Rev 71, 158–229.
Crooks, G. E., Hon, G., Chandonia, J.-M. & Brenner, S. E. (2004). WebLogo: a sequence logo generator. Genome Res 14, 1188–1190.
Davidov, Y., Rozen, R., Smulski, D. R., Van Dyk, T. K., Vollmer, A. C., Elsemore, D. A., LaRossa, R. A. & Belkin, S. (2000). Improved bacterial SOS promoter : : lux fusions for genotoxicity detection. Mutat Res 466, 97–107.[Medline]
Ebina, Y., Takahara, Y., Kishi, F., Nakazawa, A. & Brent, R. (1983). LexA protein is a repressor of the colicin E1 gene. J Biol Chem 258, 13258–13261.
Erill, I., Escribano, M., Campoy, S. & Barbe, J. (2003). In silico analysis reveals substantial variability in the gene contents of the gamma proteobacteria LexA-regulon. Bioinformatics 19, 2225–2236.
Fernandez De Henestrosa, A. R., Ogi, T., Aoyagi, S., Chafin, D., Hayes, J. J., Ohmori, H. & Woodgate, R. (2000). Identification of additional genes belonging to the LexA regulon in Escherichia coli. Mol Microbiol 35, 1560–1572.[CrossRef][Medline]
Gascuel, O. & Steel, M. (2006). Neighbor-joining revealed. Mol Biol Evol 23, 1997–2000.
Gordon, D. M. & O'Brien, C. L. (2006). Bacteriocin diversity and the frequency of multiple bacteriocin production in Escherichia coli. Microbiology 152, 3239–3244.
Gratia, A. (1925). Sur un remarquable exemple d'antagonisme entre deux souches de colilbacille. Comp Rend Soc Biol 93, 1040–1041 (in French).
Kelley, W. L. (2006). Lex marks the spot: the virulent side of SOS and a closer look at the LexA regulon. Mol Microbiol 62, 1228–1238.[CrossRef][Medline]
Kim, B. & Little, J. W. (1992). Dimerization of a specific DNA-binding protein on the DNA. Science 255, 203–206.
Kolaczkowski, B. & Thornton, J. W. (2004). Performance of maximum parsimony and likelihood phylogenetics when evolution is heterogeneous. Nature 431, 980–984.[CrossRef][Medline]
Kumar, S., Tamura, K. & Nei, M. (2004). MEGA3: integrated software for Molecular Evolutionary Genetics Analysis and sequence alignment. Brief Bioinform 5, 150–163.
Lazdunski, C. J., Bouveret, E., Rigal, A., Journet, L., Lloubes, R. & Benedetti, H. (1998). Colicin import into Escherichia coli cells. J Bacteriol 180, 4993–5002.
Lewis, L. K., Harlow, G. R., Gregg-Jolly, L. A. & Mount, D. W. (1994). Identification of high affinity binding sites for LexA which define new DNA damage-inducible genes in Escherichia coli. J Mol Biol 241, 507–523.[CrossRef][Medline]
Little, J. W. & Mount, D. W. (1982). The SOS regulatory system of Escherichia coli. Cell 29, 11–22.[CrossRef][Medline]
Lloubes, R., Granger-Schnarr, M., Lazdunski, C. & Schnarr, M. (1988). LexA repressor induces operator-dependent DNA bending. J Mol Biol 204, 1049–1054.[CrossRef][Medline]
Lloubes, R., Lazdunski, C., Granger-Schnarr, M. & Schnarr, M. (1993). DNA sequence determinants of LexA-induced DNA bending. Nucleic Acids Res 21, 2363–2367.
Lu, F. M. & Chak, K. F. (1996). Two overlapping SOS-boxes in ColE operons are responsible for the viability of cells harboring the Col plasmid. Mol Gen Genet 251, 407–411.[Medline]
Mount, D. W. (1977). A mutant of Escherichia coli showing constitutive expression of the lysogenic induction and error-prone DNA repair pathways. Proc Natl Acad Sci U S A 74, 300–304.
Mrak, P., Podlesek, Z., van Putten, J. P. M. & Zgur-Bertok, D. (2007). Heterogeneity in expression of the Escherichia coli colicin K activity gene cka is controlled by the SOS system and stochastic factors. Mol Genet Genomics 277, 391–401.[CrossRef][Medline]
Mulec, J., Podlesek, Z., Mrak, P., Kopitar, A., Ihan, A. & Zgur-Bertok, D. (2003). A cka–gfp transcriptional fusion reveals that the colicin K activity gene is induced in only 3 percent of the population. J Bacteriol 185, 654–659.
Norman, A., Hansen, L. H. & Sorensen, S. J. (2005). Construction of a ColD cda promoter-based SOS-green fluorescent protein whole-cell biosensor with higher sensitivity toward genotoxic compounds than constructs based on recA, umuDC, or sul4 promoters. Appl Environ Microbiol 71, 2338–2346.
Perez-Martin, J. & de Lorenzo, V. (1997). Clues and consequences of DNA bending in transcription. Annu Rev Microbiol 51, 593–628.[CrossRef][Medline]
Prieto, A. I., Ramos-Morales, F. & Casadesus, J. (2004). Bile-induced DNA damage in Salmonella enterica. Genetics 168, 1787–1794.
Pugsley, A. P. (1985). Escherichia coli K12 strains for use in the identification and characterization of colicins. J Gen Microbiol 131, 369–376.
Pugsley, A. P. & Schwartz, M. (1983). A genetic approach to the study of mitomycin-induced lysis of Escherichia coli K-12 strains which produce colicin E2. Mol Gen Genet 190, 366–372.[CrossRef][Medline]
Riley, M. A. & Wertz, J. E. (2002). Bacteriocins: evolution, ecology, and application. Annu Rev Microbiol 56, 117–137.[CrossRef][Medline]
Riley, M. A., Pinou, T., Wertz, J. E., Tan, Y. & Valletta, C. M. (2001). Molecular characterization of the klebicin B plasmid of Klebsiella pneumoniae. Plasmid 45, 209–221.[CrossRef][Medline]
Ronen, M., Rosenberg, R., Shraiman, B. I. & Alon, U. (2002). Assigning numbers to the arrows: parameterizing a gene regulation network by using accurate expression kinetics. Proc Natl Acad Sci U S A 99, 10555–10560.
Ronquist, F. & Huelsenbeck, J. P. (2003). MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19, 1572–1574.
Rosen, R., Davidov, Y., LaRossa, R. A. & Belkin, S. (2000). Microbial sensors of ultraviolet radiation based on recA' : : lux fusions. Appl Biochem Biotechnol 89, 151–160.[CrossRef][Medline]
Salles, B. & Weinstock, G. M. (1989). Mutation of the promoter and LexA binding sites of cea, the gene encoding colicin E1. Mol Gen Genet 215, 483–489.[CrossRef][Medline]
Smarda, J. & Smajs, D. (1998). Colicins – exocellular lethal proteins of Escherichia coli. Folia Microbiol (Praha) 43, 563–582.[CrossRef][Medline]
Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22, 4673–4680.
Ujvari, A. & Martin, C. T. (2000). Evidence for DNA bending at the T7 RNA polymerase promoter. J Mol Biol 295, 1173–1184.[CrossRef][Medline]
van der Lelie, D., Regniers, L., Borremans, B., Provoost, A. & Verschaeve, L. (1997). The VITOTOX test, an SOS bioluminescence Salmonella typhimurium test to measure genotoxicity kinetics. Mutat Res 389, 279–290.[Medline]
Van Dyk, T. K. & Rosson, R. A. (1998). Photorhabdus luminescens luxCDABE promoter probe vectors. Methods Mol Biol 102, 85–95.[Medline]
Van Dyk, T. K., DeRose, E. J. & Gonye, G. E. (2001a). LuxArray, a high-density, genomewide transcription analysis of Escherichia coli using bioluminescent reporter strains. J Bacteriol 183, 5496–5505.
Van Dyk, T. K., Wei, Y., Hanafey, M. K., Dolan, M., Reeve, M. J., Rafalski, J. A., Rothman-Denes, L. B. & LaRossa, R. A. (2001b). A genomic approach to gene fusion technology. Proc Natl Acad Sci U S A 98, 2555–2560.
Vankemmelbeke, M., Healy, B., Moore, G. R., Kleanthous, C., Penfold, C. N. & James, R. (2005). Rapid detection of colicin E9-induced DNA damage using Escherichia coli cells carrying SOS promoter–lux fusions. J Bacteriol 187, 4900–4907.
Walker, G. C. (1987). The SOS response of Escherichia coli. In Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology, pp. 1346–1357. Edited by F. C. Neidhardt, J. L. Ingraham, K. B. Low, B. Magasanik, M. Schaechter & H. E. Umbarger. Washington, DC: American Society for Microbiology.
Walker, G. C. (1995). SOS-regulated proteins in translesion DNA synthesis and mutagenesis. Trends Biochem Sci 20, 416–420.[CrossRef][Medline]
Received 19 December 2007;
revised 3 March 2008;
accepted 6 March 2008.
This article has been cited by other articles:
![]() |
J. K. Christenson and D. M. Gordon Evolution of colicin BM plasmids: the loss of the colicin B activity gene Microbiology, May 1, 2009; 155(5): 1645 - 1655. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Arnold, K. Zeth, and D. Linke Structure and Function of Colicin S4, a Colicin with a Duplicated Receptor-binding Domain J. Biol. Chem., March 6, 2009; 284(10): 6403 - 6413. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |