|
|
||||||||
1 Institute of Biology, Leiden University, Wassenaarseweg 64, 2333 AL Leiden, The Netherlands
2 Institute of Infection, Immunity & Inflammation, Centre for Biomolecular Sciences, University of Nottingham, Nottingham NG27 2RD, UK
3 Wageningen University, Laboratory of Bioinformatics, Genome Informatics Group, PO Box 8128, 6700 ET Wageningen, The Netherlands
4 Institute of Medical Microbiology, University of Zürich, Gloriastr. 32, CH-8006 Zürich, Switzerland
Correspondence
Guido V. Bloemberg
bloemberg{at}immv.uzh.ch
| ABSTRACT |
|---|
|
|
|---|
The GenBank/EMBL/DDBJ accession number for the nucleotide sequence of the P. putida PCL1445 oprM-psoR-psoA-psoB-psoC-macA-macB DNA region is DQ151887.
| INTRODUCTION |
|---|
|
|
|---|
The diverse roles and functions of CLPs seem to be determined by their structure. However, this structure–function relationship is still not well understood.
CLPs are versatile molecules with antimicrobial, cytotoxic and surfactant properties. CLPs are produced by members of the genera Bacillus, Serratia, Burkholderia and Pseudomonas (Neu, 1996
; Lindum et al., 1998
; Huber et al., 2002
; Raaijmakers et al., 2006
). The CLP viscosinamide produced by a Pseudomonas sp. isolated from the sugar beet rhizosphere has antibiotic properties towards root-pathogenic fungi (Nielsen et al., 1999
). CLPs of Bacillus sp. were reported to permeabilize membranes, resulting in pore formation and haemolysis (Grangemard et al., 2001) and to play a role in bacterial attachment to surfaces (Neu, 1996
). Lipopeptides produced by Serratia (Lindum et al., 1998
) and Burkholderia (Huber et al., 2002
) were shown to be essential for the stimulation of swarming motility and thus could contribute to the regulation of biofilm formation (Huber et al., 2002
).
Structural identification showed one difference between putisolvin I and II. This consists of a Val-11 in putisolvin I and an Ile-11 or Leu-11 in putisolvin II, which accounts for a mass difference of 14 Da (Kuiper et al., 2004
). Other known Pseudomonas lipopeptides, such as viscosinamide (Nielsen et al., 1999
), syringomycin (Hutchison et al., 1995
), amphisin (Sørensen et al., 2001
), tensin (Henriksen et al., 2000
) and arthrofactin (Roongsawang et al., 2003
), have a shorter amino acid moiety and the fatty acid chain is longer. Cyclization also appears to be different for the previously described lipopeptides, in which an ester linkage is formed between the C-terminal carboxyl group and the side-chain of the first or third amino acid. In contrast, this linkage involves the ninth amino acid residue in the case of putisolvin I and II (Kuiper et al., 2004
). The lipopeptides produced by Pseudomonas syringae and Pseudomonas tolaasii (Nutkins et al., 1991
) have a longer fatty acid chain than putisolvins I and II.
CLPs are produced nonribosomally by large, multifunctional peptide synthetases via a thiotemplate mechanism (Marahiel et al., 1997
; Stachelhaus et al., 1999
). The genes encoding multimodular nonribosomal peptide synthetases (NRPSs) for syringomycin and syringopeptin (Kleinkauf & von Döhren, 1996
; Guenzi et al., 1998
; Scholz-Schroeder et al., 2003
) of P. syringae pv. syringae B301D and arthrofactin of Pseudomonas sp. MIS38 (Roongsawang et al., 2003
) have been cloned and characterized. NRPSs recognize, activate, modify and link the amino acid intermediates to the product (Marahiel et al., 1997
). The order and number of the modules of an NRPS protein are, in many cases, collinear to the amino acid sequence of the corresponding peptide moiety of the final CLP molecule (collinearity rule). Each module of the NRPSs can be further subdivided into domains, each of which exhibits a single enzymic activity. The adenylation (A) domain is responsible for amino acid recognition and adenylation at the expense of ATP. The thiolation (T) or peptidyl carrier protein domain is the attachment site of the 4'-phosphopantetheine cofactor and serves as a carrier of thioesterified amino acid intermediates. The condensation (C) domain catalyses peptide bond formation between two consecutive amino acids. Modifying domains such as the epimerization (E) domain catalyse the conversion of L-amino acids to their D-isomers. Finally, cyclization and release of the peptide product are catalysed by the C-terminal thioesterase (Te) domain.
P. putida strain PCL1445 was indicated to produce putisolvin I and II via a NRPS (Kuiper et al., 2004
). Relatively little is known about the genetic network involving the perception of external factors and the signal-transduction pathways that drive transcription of the CLP biosynthetic genes. The GacS/GacA two-component system appears to serve as a master switch for the production of CLPs in several Pseudomonas genera (Bender et al., 1999
; Koch et al., 2002
; Dubern et al., 2005
). Our previous results showed that the DnaK heat-shock protein plays an important role in putisolvin biosynthesis at the transcriptional level and that it is positively regulated by GacA/GacS (Dubern et al., 2005
). Putisolvins I and II are strongly upregulated at low temperatures and require DnaK (Dubern et al., 2005
). In addition, we showed that a quorum-sensing system consisting of ppuI, rsaL and ppuR regulates the expression of putisolvin production and biofilm formation (Dubern et al., 2006
).
This study aimed at the isolation, sequencing and characterization of the putisolvin biosynthetic gene(s) and characterization of the surrounding genes for their possible regulatory role in putisolvin production.
| METHODS |
|---|
|
|
|---|
|
To isolate the chromosomal DNA region flanking the Tn5, total genomic DNA was isolated and digested with EcoRI, the restriction site of which is not present in pRL1063a (Wolk et al., 1991
). DNA fragments were circularized by self-ligation and selected for kanamycin resistance, resulting in plasmids maintained via OriV (p15A) and containing genomic DNA regions flanking the Tn5luxAB. All DNA techniques were performed as described by Sambrook & Russell (2001)
. Sequencing of the plasmids was performed by BaseClear. DNA sequences were analysed with the software packages provided by the NCBI (National Center for Biotechnology Information) BLAST network server.
Bacterial artificial chromosome (BAC) DNA analysis.
A BAC library of P. putida strain PCL1445 was constructed by Bio S&T, using pIndigoBAC-5 (EPICENTRE) as a cloning vector for high-molecular-mass inserts (Table 1
).
To isolate a genomic fragment containing the putisolvin biosynthetic gene(s) the resulting fragment library was screened for the presence of the entire lipopeptide biosynthetic gene cluster by colony blotting (Sambrook & Russell, 2001
) using four different probes. The probes were obtained by PCR using PCL1445 chromosomal DNA as a template and primers derived from sequences of regions flanking Tn5 mutants oMP907 (5'-GCATGCAAGCGATGAAAGCAGATGACCCAG-3') and oMP908 (5'-GCATGCGTCGGCAGGTCCTTCTGATTGATC-3'), resulting in a 0.75 kb product PCR1, oMP872 (5'-ACCTCAGTGAATGGACCCTTG-3'), and oMP873 (5'-GAGCTGTTTTTCACGTTCAGC-3'), resulting in a 0.58 kb product PCR2, oMP893 (5'-ATCACATCGCCATGGACCACA-3'), and oMP894 (5'-ACAAGGCCTTCAAGGACCTGCT-3'), resulting in a 0.65 kb product PCR3, oMP891 (5'-ATCGATGAATTCACCGGCCTGG-3'), and oMP892 (5'-CCCAGCAACTGGTTGGCGATCT-3'), resulting in a 0.35 kb product, PCR4.
The labelling and detection of the DNA probes were performed using the AlkPhos Direct Labelling and Detection system (GE). Hybridization of DNA was detected by the emission of light after applying a Fuji medical X-ray film.
Sequencing of the BAC DNA of pMP7598 was performed by Macrogen.
For insert size determination BAC DNA was isolated with the Qiagen large construct kit and digested to completion with SpeI (New England Biolabs). This digest was separated by pulsed-field gel electrophoresis using the Bio-Rad CHEF system on a 1 % SeaKEM LE agarose gel in 0.5x Tris/borate/EDTA buffer, with switch-times of 10–40 s for 44 h with a set angle of 12 ° in a field of 5 V cm–1 at 10 °C, along with a Lambda concatemer PFGE marker (New England Biolabs) and the 1 kb plus DNA ladder (Invitrogen) supplemented with a complete XhoI digest of Lambda (Fermentas).
BAC DNA that was isolated with the Qiagen large construct kit was sheared by nebulization, fractionated by gel electrophoresis, and fragments 2.5–3.0 kb in size were cloned into the dephosphorylated EcoRV site of pBlueScript I SK+ (Stratagene) using standard methods (Sambrook & Russell, 2001
). Shotgun templates were prepared from XL2 transformants (Stratagene) and sequenced using the DYEnamic ET Terminator Cycle Sequencing kit (GE Healthcare Life Sciences). For gap closure, PCR products were amplified with custom-made primers using a regular PCR protocol with 4 % (v/v) DMSO. Typically a 20 µl PCR contained 0.5 µl 5 µM forward and 0.5 µl 5 µM reverse custom primer, 1 µl 2.5 mM dNTPs, 2 µl 25 mM MgCl2, 2 µl 10x GoldStar buffer (200 mM Tris/HCl pH 9.0, 5 mM MgCl2), 0.8 µl DMSO, 0.2 µl 5 units µl–1 Goldstar (Eurogentec) polymerase, and 1 µl 10 µg µl–1 template DNA from a gap-spanning clone or the BAC. Sequencing reactions were carried out in a 10 µl reaction mixture with 0.5 µl Amerdye (GE), 1 µl sequence primer, 3.5 µl sequence buffer (200 mM Tris/HCl pH 9.0, 10 mM MgCl2), and 5 µl template DNA. Sequence PCRs were analysed on a 3730 XL DNA analyser (Applied Biosystems).
Using the PREGAP4 module of the Staden package 2004, raw trace data were processed into assembly-ready sequences. Sequences were base called by the PHRED base caller (Ewing & Green, 1998
; Ewing et al., 1998
). Clipping was performed to remove sequencing vector, cloning vector and poor-quality sequences. Processed sequences were subsequently assembled with GAP4, with a sequence percentage mismatch threshold of 8 %, and parsed into the GAP4 assembly database. The GAP4 contig editor interface was used for editing and finishing. Consensus calculations with a quality cutoff score of 40 were performed from within GAP4 using a probabilistic consensus algorithm based on the expected error rates output by PHRED.
To manage the sequence, assembly and scaffolding of the data, TOPAAS (Peters et al., 2006
) was used. The software is implemented on a SUN V440 server running Solaris 2.9. Primers for gap closing are automatically designed on contig end sequences, using Primer3 as a core primer design program. Maximum distance of primer positions to contig ends is set to 400 bp.
Protein-encoding ORFs were predicted using Glimmer 2.0 (Delcher et al., 1999
) and GeneMark.hmm for Prokaryotes version 2.4 (Lukashin & Borodovsky, 1998
) using the Pseudomonas fluorescens Pf01 genome as a reference. The predicted genes were used in a BLAST search (Altschul et al., 1990
) to assign putative gene-names and function by homology transfer.
The DNA sequence was analysed with VectorNTI Advanced 10.1.1 software (Invitrogen) and BLAST programs (www.ncbi.nlm.nih.gov/BLAST/) (Altschul et al., 1990
). Amino acid sequences of the NRPS involved in putisolvin biosynthesis were compared and analysed with NRPS-PKS web-based software (www.nil.res.in/nrps-pks.html) (Ansari et al., 2004
).
Construction of psoR, macA and macB mutant strains.
The P. putida PCL1445 psoR mutant, PCL1626, was constructed by single homologous recombination. A 0.58 kb internal fragment of the psoR-homologous gene of strain PCL1445 was obtained by PCR using primers oMP872 (5'-ACCTCAGTGAATGGACCCTTG-3') and oMP873 (5'-GAGCTGTTTTTCACGTTCAGC-3'), cloned into the pGEM-T Easy Vector System I (Promega) and transferred as an EcoRI–EcoRI insert to pMP5285 (Kuiper et al., 2001
), resulting in pMP7570. Plasmid pMP7570 was conjugated to P. putida PCL1445 by tri-parental mating using E. coli containing pRK2013 as a helper strain (Schnider et al., 1995
). Strain PCL1626 was obtained as a kanamycin-resistant colony. The insertion of the suicide construct in psoR was confirmed by sequence analysis of the suicide plasmid that was recovered from the genomic DNA of PCL1626 using ClaI.
P. putida PCL1445 macA and macB mutants were constructed using a similar mutagenesis strategy. The macA fragment for the construction of the suicide plasmid pMP7595 resulted from a PCR using primers oMP1152 (5'-ACGTTGGAGGGCATCAAG-3') and oMP1153 (5'-GTTTGTCTTCGCCCAGGATA-3'), with chromosomal DNA of strain PCL1445 as a template. Single homologous recombination in macA resulted in strain PCL1644. The macB fragment of PCL1445 for the construction of the suicide plasmid pMP7597 resulted from a PCR using primers oMP1154 (5'-AAGGGCTATGTGCTCAAGGA-3') and oMP1155 (5'-CGTTGCAGCATCAGTTTTGT-3'), with chromosomal DNA of strain PCL1445 as a template. Single homologous recombination in macB resulted in strain PCL1645.
Complementation of macA and macB mutants of PCL1445.
Complementation of mutants PCL1644 (macA) and PCL1645 (macB) was carried out using pMP7596, a shuttle vector derived from pME6010 (Heeb et al., 2000
) in which a 3.6 kb fragment containing macA and macB of strain PCL1445 was inserted. This insert was obtained by PCR using primers oMP1156 (5'-GGGGAATTCTTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTTCACACAGGAAACAGCTAAATGGAAAAGTCCAGATTCCG-3') containing the sequence of a Ptac promoter and oMP1158 (5'-CGATGCTGGAGAAACACATC-3'). pMP5518 was transferred to strains PCL1644 and PCL1645 by tri-parental mating as described above and transformants were selected on KB agar medium supplemented with tetracycline (40 µg ml–1).
Quantification of fluorescence in gfp reporter strains.
Expression of psoA : : gfp (Dubern et al., 2005
) was quantified using an HTS7000 Bio Assay Reader (Perkin Elmer). Bacterial strains were grown to an OD620 of 2.0 and diluted to OD620 0.6. Fluorescence of the diluted cultures was quantified using a white 96-well microtitre plate containing 200 µl culture aliquots. Fluorescence of the cultures was determined at an excitation wavelength of 485 nm and an emission wavelength of 520 nm.
Quantification of putisolvin production.
Putisolvin (biosurfactant) production in KB or BM culture medium was quantified by two different methods. First, the decrease of surface tension between culture medium and air was measured using a Du Nouy ring (K6 Krüss) as previously described (Kuiper et al., 2004
).
Secondly, putisolvin production was analysed by HPLC. Briefly, 7 ml of a KB culture supernatant was extracted with 1 vol. ethyl acetate (Fluka) as described previously (Kuiper et al., 2004
). Ethyl acetate extracts obtained from 7 ml culture supernatant were prepared as described previously (Dubern et al., 2005
) and separated by HPLC (Jasco), using a reverse-phase C8 5 µm Econosphere column (Alltech), a PU-980 pump system (Jasco), an LG-980-02 gradient unit (Jasco) and an MD 910 detector (Jasco) (Dubern et al., 2005
). Chromatograms were analysed in the wavelength range between 195 nm and 420 nm. The amount of putisolvins produced was determined as the area of the peak detected in micro-absorbance units (µAU) at 206 nm.
| RESULTS |
|---|
|
|
|---|
|
An additional ORF was identified downstream of orf1 (Fig. 1
). The predicted ORF2 protein was most similar to outer-membrane proteins associated with secretion systems in Gram-negative bacteria. The highest degree of similarity to ORF2 was shown by OprM of P. aeruginosa (Nakajima et al., 2000
), which shares 63 % identity at the amino acid level.
Analysis of the sequence downstream of psoC revealed the presence of two ORFs that are predicted to encode homologues of MacA and MacB of E. coli (Fig. 1
). The macA gene of P. putida is 1.15 kb in length and has a similarity of 85 % at amino acid level with macA of Pseudomonas entomophila L48, 76 % similarity with Pseudomonas sp. MIS38 and P. syringae pv. tomato DC3000, and 75 % similarity with P. fluorescens Pf-5. The macB gene of P. putida is 2.01 kb in length and has a similarity of 88 % at amino acid level with macA of P. entomophila L48, 82 % similarity with P. syringae pv. tomato DC3000, and 80 % similarity with P. fluorescens Pf-5 and Pseudomonas sp. MIS38.
No typical E. coli
70 promoter was found upstream of psoB or psoC and no
-independent terminator-like structure was found in the region downstream of psoC. The psoC and macA genes are separated by only 66 bp and no putative promoter sequence could be predicted in the region upstream of macA. Moreover, the intergenic region between macA and macB spans only 5 bp. Consequently, we hypothesize that psoA, psoB, psoC, macA and macB could form a single operon with a promoter element upstream of psoA.
Isolation and characterization of putisolvin biosynthetic mutants
In order to isolate mutants in the biosynthetic pso cluster of PCL1445, 2400 Tn5luxAB transposants were screened for loss of surfactant activity as judged by the drop-collapsing assay, using cells derived from a single colony. This resulted in strains PCL1436 (Kuiper et al., 2004
), PCL1630, PCL1633 and PCL1634 (Dubern et al., 2005
).
Sequence analysis of the chromosomal regions flanking the Tn5luxAB showed the sites of insertion. The Tn5 in strain PCL1634 was inserted in psoA, 3534 bp downstream from its transcriptional start. The insertion of the Tn5 in PCL1633 was found to be positioned in psoB, 18 618 bp downstream of the predicted transcriptional start of the pso gene cluster. The Tn5 in strain PCL1436 was inserted in psoC, 29 301 bp downstream of the start site. The Tn5 in PCL1630 was located in psoC, 39 707 bp downstream from the predicted transcriptional start of psoA (Fig. 2
).
|
|
Most of the consensus amino acid residues identified within other NRPS modules were highly conserved in the NRPS modules of PsoA, B and C (Table 2
). The condensation domains within PsoA, PsoB and PsoC are thought to catalyse the formation of the amide bond between consecutively bound thioesterified intermediates of putisolvins. The conserved motif HHxxD(H/G) was identified in each of the 12 condensation domains (Table 2
).
|
|
|
The psoR, macA and macB genes are involved in putisolvin biosynthesis
To investigate whether psoR, macA and macB are involved in putisolvin production, insertion mutants of PCL1445 were constructed by single homologous recombination using suicide plasmids pMP7570, pMP7595 and pMP7597 (see Methods), resulting in strains PCL1626 (psoR), PCL1644 (macA) and PCL1645 (macB), respectively. The proper integration of pMP7570, pMP7595 and pMP7597 was confirmed by sequence analysis (data not shown).
Biosurfactant production by PCL1626 (psoR) grown in KB medium under standard conditions to stationary phase was quantified by the Du Nouy ring assay. In contrast to culture supernatant of the wild-type, which decreases the surface tension between culture medium and air, culture supernatant of PCL1626 (psoR) was not able to decrease the surface tension (53 mN m–1), indicating that putisolvin production was abolished (Fig. 4a
). Quantification of putisolvins in culture supernatant using HPLC showed a 70 % decrease for PCL1644 (macA) and PCL1645 (macB) when compared to the wild-type (Fig. 4b
). Introduction of pMP7596 harbouring macA and macB genes restored putisolvin production to the wild-type level in culture supernatant of strains PCL1644 (macA) and PCL1645 (macB) (Fig. 4b
).
Influence of psoR on the expression of the pso biosynthetic genes
PsoR of strain PCL1445, which is predicted to be 260 aa in length, revealed homology to prokaryotic regulatory proteins (Fig. 5a
). Database searches with BLASTP demonstrated that approximately 60 aa in the C-terminal region of PsoR shared significant similarity with similar regions of known regulatory proteins. The C terminus of PsoR exhibited 35 % identity to GerE (Cutting & Mandelstam, 1986
), 34 % identity to DctR (Hamblin et al., 1993
) and 32 % identity to FixJ (Anthamatten & Hennecke, 1991
) (Fig. 5a
).
|
To determine whether PsoR regulates putisolvin expression in PCL1445, a psoA : : gfp transcriptional fusion (Dubern et al., 2005
) was introduced into PCL1626 (psoR). The expression of the gfp reporter strongly decreased in the psoR mutant when compared to the wild-type strain (Fig. 5b
).
| DISCUSSION |
|---|
|
|
|---|
Analysis of the homologies and selectivity-conferring code of the amino-acid-specific A-domains showed a higher affinity of the PsoA-M11 A-domain for Val than for Leu or Ile (Table 2
). This finding at the genetic level supports our previous work, in which it was shown first that putisolvin I is produced at a higher level (1.6-fold) than putisolvin II (Kuiper et al., 2004
; Dubern et al., 2005
, 2006
), and secondly that the ratio between putisolvin I and putisolvin II was affected by the availability of L-Val, L-Leu or L-Ile in the culture medium (Dubern & Bloemberg, 2006
). Most interestingly, studies on the environmental regulation of putisolvin biosynthesis showed that environmental conditions that do not favour bacterial growth, including low temperature, and which PCL1445 is most likely to encounter in its natural environment, have a strong positive effect on the level of putisolvin produced (Dubern et al., 2005
). In addition, Stachelhaus et al. (1999)
provided in silico evidence that certain signature sequences in the A-domains contain adaptable or so-called wobble-like positions which can result in a high variability of amino acid usage. Our experimental data raise the question of a possible connection between flexibility with respect to amino acid usage and environmental conditions. In particular, it will be interesting to investigate the flexibility of module 11 for Val, Leu or Ile usage at different temperatures through the analysis of the ratio between putisolvin I and II at different temperatures.
No internal E-domain for the conversion from L to D form was detected in the pso synthetic cluster. This is similar to previous studies on syringopeptin (Scholz-Schroeder et al., 2003
), arthrofactin (Roongsawang et al., 2003
), and the predicted lipodecapeptide of strain Pf-5 (Paulsen et al., 2005
) in which no internal E-domains were found. This observation suggests the presence of an external racemase, which recently was further supported by the discovery of specific sequence motifs in the T-domains of the arf synthetic template (Roongsawang et al., 2003
). Based on comparative analysis of the different conserved sequence motifs present within the T-domains of putisolvin synthetase and the arthrofactin synthetic template, the present study shows that the first nine T-domains in pso are responsible for transferring D-amino acids and T10 and T11 for transferring L amino acids in the putisolvin structure. Interestingly, analysis of the last T-domain, T12, did not allow determination of whether L- or D-Ser was incorporated (Fig. 3
). This finding suggests the existence of a flexibility of module 12 for the transfer of a D- or L-serine at that particular position.
An ORF located upstream of psoA was identified as a member of the LuxR family of regulatory proteins based on homology analysis, and referred to as psoR (Fig. 1
). Sequence analysis revealed the presence of HTH DNA-binding motifs at the C terminus of PsoR (Fig. 5a
). The HTH motif has been observed in many regulatory proteins (Pabo & Sauer, 1992
), which are divided into more than 10 groups, including the LuxR, AraC and MarR families. PsoR appears to be most closely related to members of the LuxR regulatory family, such as DctR (Hamblin et al., 1993
) and FixJ (Anthamatten & Hennecke, 1991
). An approximately 60 aa region of the C terminus containing the four helices and their turns, which is called a three-element fingerprint, provides the signature for the HTH motif of the LuxR family of bacterial regulatory proteins. The observation that the PsoR protein exhibits the highest similarity to DctR and FixJ and contains the three-element fingerprint suggests that it is a member of the LuxR family (Fig. 5a
). Despite this homology, PsoR lacks five highly conserved residues at the N terminus characteristic of the LuxR subfamily, which is composed of autoinducer-binding regulators activated by homoserine lactones (Fuqua et al., 1996
). The second major subfamily of transcriptional regulators is composed of the response regulators of two-component signal transduction systems, such as FixJ (Anthamatten & Hennecke, 1991
) and DctR (Hamblin et al., 1993
). Three highly conserved residues (Arg, Glu, Lys) characteristic of the response regulators were found in the PsoR sequence, suggesting that PsoR may be closely related to this subfamily of regulators (Fig. 5a
).
A mutation in PsoR abolished putisolvin production in the wild-type strain (Fig. 4a
), giving the first evidence of its regulatory role in putisolvin biosynthesis. The decrease of expression of the psoA : : gfp fusion in psoR mutant when compared to the wild-type (Fig. 5b
) suggests that the effect of psoR on putisolvin production can be accounted for by its effect on psoA transcriptional activity, although PsoR may regulate other genes involved in putisolvin production as well. This evidence was supported by the identification of a nucleotide consensus sequence similar to those involved in the regulation of response regulators such as TyrR (Yang et al., 2004
). In E. coli, the TyrR protein can act both as a repressor and as an activator of transcription. The regulation of transcription is determined by the position and nature of the recognition site (TyrR boxes) associated with each of the promoters (Pittard et al., 2005
).
Sequence analysis revealed almost immediately downstream (66 bp) of psoC the presence of two ORFs, which encode homologues of MacA and MacB of E. coli (Kobayashi et al., 2001
). This genetic organization is similar to that of other lipopeptide synthetic clusters including those of P. fluorescens Pf-5 (Paulsen et al., 2005
) and Pseudomonas sp. MIS38 (Roongsawang et al., 2003
), in which macA and macB were not characterized. The MacA and MacB proteins, along with a TolC outer-membrane protein, form a macrolide-specific ABC-type efflux carrier in which MacB is an integral membrane protein with four transmembrane segments and one nucleotide-binding domain, while MacA belongs to a membrane fusion protein (MFP) family with a signal-like sequence at its N terminus (Kobayashi et al., 2001
; Rouquette-Loughlin et al., 2005
). Interestingly, Kobayashi et al. (2001)
showed that macA and macB genes conferred resistance against macrolides composed of 14- and 15-membered lactones but no or weak resistance against 16-membered ones. Mutations of macA or macB of strain PCL1445 resulted in reduced putisolvin production (Fig. 4b
). This preliminary characterization of the mutants in macA and macB suggests that these two ORFs are (directly or indirectly) involved in putisolvin production and are possibly coregulated with psoA–C. In a recent report (Dubern et al., 2006
), we showed that the psoA promoter region includes a putative lux box that could be involved in the regulation of putisolvin biosynthesis by a quorum-sensing mechanism. It will therefore be interesting to know whether the psoA-psoB-psoC-macA-macB genes are organized in an operon and to further investigate the relationship between psoR and the previously described ppu quorum-sensing system (Dubern et al., 2006
).
| ACKNOWLEDGEMENTS |
|---|
Edited by: M. A. Kertesz
| REFERENCES |
|---|
|
|
|---|
Ansari, M. Z., Yadav, G., Gokhale, R. S. & Mohanty, D. (2004). NRPS-PKS: a knowledge-based resource for analysis of NRPS/PKS megasynthases. Nucleic Acids Res 32, 405–423.[CrossRef]
Anthamatten, D. & Hennecke, H. (1991). The regulatory status of the FixL-like and Fix-J-like genes in Bradyrhizobium japonicum may be different from that in Rhizobium meliloti. Mol Gen Genet 225, 38–48.[Medline]
Bairoch, A. (1993). The PROSITE dictionary of site and patterns in proteins, its current status. Nucleic Acids Res 21, 3097–3103.
Bender, C. L., Alarcon-Chalaidez, F. & Gross, D. C. (1999). Pseudomonas syringae phytotoxins: mode of action, regulation, and biosynthesis by peptide and polyketide synthetases. Microbiol Mol Biol Rev 63, 266–292.
Cutting, S. & Mandelstam, J. (1986). The nucleotide sequence and the transcription during sporulation of gerE gene of Bacillus subtilis. J Gen Microbiol 132, 3013–3024.
Delcher, A. L., Harmon, D., Kasif, S., White, O. & Salzberg, S. L. (1999). Improved microbial gene identification with GLIMMER. Nucleic Acids Res 27, 4636–4641.
Ditta, G., Stanfield, S., Corbin, D. & Helinski, D. R. (1980). Broad host range DNA cloning system for gram-negative bacteria: construction of a gene bank of Rhizobium meliloti. Proc Natl Acad Sci U S A 77, 7347–7351.
Dubern, J.-F. & Bloemberg, G. V. (2006). Influence of environmental conditions on putisolvins I and II production in Pseudomonas putida strain PCL1445. FEMS Microbiol Lett 263, 169–175.[CrossRef][Medline]
Dubern, J.-F., Lagendijk, E. L., Lugtenberg, B. J. J. & Bloemberg, G. V. (2005). The heat shock genes dnaK, dnaJ, and grpE are involved in regulation of putisolvin biosynthesis in Pseudomonas putida PCL1445. J Bacteriol 187, 5967–5976.
Dubern, J.-F., Lugtenberg, B. J. J. & Bloemberg, G. V. (2006). The ppuI-rsaL-ppuR quorum sensing system regulates biofilm formation of Pseudomonas putida PCL1445 by controlling biosynthesis of the cyclic lipopeptides putisolvin I and II. J Bacteriol 188, 2898–2906.
Ewing, B. & Green, P. (1998). Basecalling of automated sequencer traces using PHRED. II. Error probabilities. Genome Res 8, 186–194.
Ewing, B., Hillier, L., Wendle, M. C. & Green, P. (1998). Base-calling of automated sequencer traces using PHRED. I. Accuracy assessment. Genome Res 8, 175–185.
Feil, H., Feil, W. S., Chain, P., Larimer, F., DiBartolo, G., Copeland, A., Lykidis, A., Trong, S., Nolan, M. & other authors (2005). Comparison of the complete genome sequences of Pseudomonas syringae pv. syringae B728a and pv. tomato DC3000. Proc Natl Acad Sci U S A 102, 11064–11069.
Fuqua, C., Winans, S. C. & Greenberg, E. P. (1996). Census and consensus in bacterial ecosystems: the LuxR-LuxI family of quorum sensing transcriptional regulators. Annu Rev Microbiol 50, 727–751.[CrossRef][Medline]
Grangemard, I., Wallach, J., Maget-Dana, R. & Peypoux, F. (2001). Lichenysin: a more efficient cation chelator than surfactin. Appl Biochem Biotechnol 90, 199–210.[CrossRef][Medline]
Guenzi, E., Galli, G., Grgurina, I., Gross, D. C. & Grandi, G. (1998). Characterization of the syringomycin synthetase gene cluster: a link between prokaryotic and eukaryotic peptide synthetases. J Biol Chem 273, 32857–32863.
Hamblin, M. J., Shaw, J. G. & Kelly, D. J. (1993). Sequence analysis and interposon mutagenesis of a sensor-kinase (DctS) and response-regulator (DctR) controlling synthesis of the high-affinity C4-dicarboxylate transport system in Rhodobacter capsulatus. Mol Gen Genet 237, 215–224.[Medline]
Hanahan, D. (1983). Studies on transformation of Escherichia coli with plasmids. J Mol Biol 166, 557–580.[Medline]
Heeb, S., Itoh, Y., Nishijyo, T., Schnider, U., Keel, C., Wade, J., Walsh, U., O'Gara, F. & Haas, D. (2000). Small, stable shuttle vectors based on the minimal pVS1 replicon for use in gram-negative, plant-associated bacteria. Mol Plant Microbe Interact 13, 232–237.[Medline]
Henriksen, A., Anthoni, U., Nielsen, T. H., Sørensen, J., Christophersen, C. & Gajhede, M. (2000). Cyclic lipoundecapeptide tensin from Pseudomonas fluorescens strain 96.578. Acta Crystallogr C 56, 113–115.
Huber, B., Riedel, K., Kothe, M., Givskov, M., Molin, S. & Eberl, L. (2002). Genetic analysis of function involved in the late stages of biofilm development in Burkolderia cepacia HIII. Mol Microbiol 46, 411–426.[CrossRef][Medline]
Hutchison, M. L., Tester, M. A. & Gross, D. C. (1995). Role of biosurfactants and ion-channel-forming activities of syringomycin in transmembrane ion flux – a model for the mechanism of action in the plant-pathogen interaction. Mol Plant Microbe Interact 8, 610–620.[Medline]
Jain, D. K., Thompson, D. L., Lee, H. & Trevors, J. T. (1991). A drop-collapsing test for screening surfactant-producing microorganisms. J Microbiol Methods 13, 271–279.[CrossRef]
King, E. O., Ward, M. K. & Raney, D. E. (1954). Two simple media for the demonstration of pyocyanin and fluorescin. J Lab Clin Med 44, 301–307.[Medline]
Kitten, T., Kinscherf, T. G., McEvoy, J. L. & Willis, D. K. (1998). A newly identified regulator is required for virulence and toxin production in Pseudomonas syringae. Mol Microbiol 28, 917–929.[CrossRef][Medline]
Kleinkauf, H. & von Döhren, H. (1996). A nonribosomal system of peptide biosynthesis. Eur J Biochem 236, 335–351.[Medline]
Kobayashi, N., Nishino, K. & Yamagushi, A. (2001). Novel macrolide-specific ABC-type efflux transporter in Escherichia coli. J Bacteriol 183, 5639–5644.
Koch, B., Nielsen, T. H., Sørensen, D., Andersen, J. B., Christophersen, C., Molin, S., Givskov, M., Sørensen, J. & Nybroe, O. (2002). Lipopeptide production in Pseudomonas sp. strain DSS73 is regulated by components of sugar beet seed exudates via Gac two-component regulatory system. Appl Environ Microbiol 68, 4509–4516.
Kuiper, I., Bloemberg, G. V., Noreen, S., Thomas-Oates, J. E. & Lugtenberg, B. J. (2001). Increased uptake of putrescine in the rhizosphere inhibits competitive root colonization by Pseudomonas fluorescens strain WCS365. Mol Plant Microbe Interact 14, 1096–1104.[Medline]
Kuiper, I., Lagendijk, E. L., Pickford, R., Derrick, J. P., Lamers, G. E. M., Thomas-Oates, J. E., Lugtenberg, B. J. J. & Bloemberg, G. V. (2004). Characterization of two Pseudomonas putida lipopeptide biosurfactants, putisolvin I and II, which inhibit biofilm formation and break down existing biofilms. Mol Microbiol 51, 97–113.[CrossRef][Medline]
Lindum, P. W., Anthoni, U., Christophersen, C., Eberl, L., Molin, S. & Givskov, M. (1998). N-Acyl-L-homoserine lactone autoinducer control production of an extracellular lipopeptide biosurfactant required for swarming motility of Serratia liquefaciens MG1. J Bacteriol 180, 6384–6388.
Linne, U., Doekel, S. & Marahiel, M. A. (2001). Portability of epimerization domain and role of peptidyl carrier protein on epimerization activity in nonribosomal peptide synthetases. Biochemistry 40, 15824–15834.[CrossRef][Medline]
Lugtenberg, B. J. J., Kravchenko, L. V. & Simons, M. (1999). Tomato seed and root exudates sugars: composition, utilization by Pseudomonas biocontrol strain and role in rhizosphere colonization. Environ Microbiol 1, 439–446.[CrossRef][Medline]
Lukashin, A. V. & Borodovsky, M. (1998). GeneMark.hmm: new solutions for gene finding. Nucleic Acids Res 26, 1107–1115.
Marahiel, M. A., Stachelhaus, T. & Mootz, H. D. (1997). Modular peptide synthetases involved in nonribosomal peptide synthesis. Chem Rev 97, 2651–2673.[CrossRef][Medline]
Nakajima, A., Sugimoto, Y., Yoneyama, H. & Nakae, T. (2000). Localization of the outer membrane subunit OprM of resistance-nodulation-cell division family multi-component efflux pump in Pseudomonas aeruginosa. J Biol Chem 275, 30064–30068.
Neu, T. R. (1996). Significance of bacterial surface-active compounds in interaction of bacteria with interfaces. Microbiol Rev 60, 151–166.
Nielsen, T. H., Christophersen, C., Anthoni, V. & Sørensen, J. (1999). Viscosinamide, a new cyclic depsipeptide with surfactant and antifungal properties produced by Pseudomonas fluorescens DR54. J Appl Microbiol 87, 80–90.[CrossRef][Medline]
Nutkins, J. C., Mortishire-Smith, R. J., Packman, L. C., Brodey, C. L., Rainey, P. B., Johnstone, K. & Williams, D. H. (1991). Structure determination of tolaasin, an extra-cellular lipodepsipeptide produced by the mushroom pathogen Pseudomonas tolaasii Paine. J Am Chem Soc 113, 2621–2627.[CrossRef]
Pabo, C. O. & Sauer, R. T. (1992). Transcriptional factors: structural families and principles of DNA recognition. Annu Rev Biochem 61, 1053–1095.[CrossRef][Medline]
Parkinson, J. S. & Kofoid, E. C. (1992). Communication modules in bacterial signaling proteins. Annu Rev Genet 26, 71–112.[CrossRef][Medline]
Paulsen, I. T., Press, C. M., Ravel, J., Kobayashi, D. Y., Myers, G. S. A., Mavrodi, D. V., DeBoy, R. T., Seshadri, R., Ren, Q. & other authors (2005). Complete genome sequence of the plant commensal Pseudomonas fluorescens Pf-5. Nat Biotechnol 23, 873–878.[CrossRef][Medline]
Peters, S. A., van Haarst, J. C., Jesse, T. P., Woltinge, D., Jansen, K., Hesselink, T., van Staveren, M. J., Abma-Henkens, M. H. C. & Klein-Lankhorst, R. M. (2006). TOPAAS, a tomato and potato assembly assistance system for selection and finishing of bacterial artificial chromosomes. Plant Physiol 140, 805–817.
Peypoux, F., Bonmatin, J. M. & Wallach, J. (1999). Recent trends in the biochemistry of surfactin. Appl Microbiol Biotechnol 51, 553–563.[CrossRef][Medline]
Pittard, J., Camakaris, H. & Yang, J. (2005). The TyrR regulon. Mol Microbiol 55, 16–26.[CrossRef][Medline]
Raaijmakers, J. M., de Bruijn, I. & de Kock, J. D. (2006). Cyclic lipopeptide production by plant-associated Pseudomonas spp.: diversity, activity, biosynthesis, and regulation. Mol Plant Microbe Interact 19, 699–710.[CrossRef][Medline]
Roongsawang, N., Hase, K., Haruki, M., Imanaka, T., Morikawa, M. & Kanaya, S. (2003). Cloning and characterization of the gene cluster encoding arthrofactin synthetase from Pseudomonas sp. MIS38. Chem Biol 10, 869–880.[CrossRef][Medline]
Rouquette-Loughlin, C. E., Balthazar, J. T. & Shafer, W. M. (2005). Characterization of the MacA-MacB efflux system in Neisseria gonorrhoeae. J Antimicrob Chemother 56, 856–860.
Sambrook, J. & Russell, D. W. (2001). Molecular Cloning: a Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Schnider, U., Keel, C., Voisard, C., Defago, G. & Haas, D. (1995). Tn5-directed cloning of pqq genes from Pseudomonas fluorescens CHAO: mutational inactivation of the genes results in overproduction of the antibiotic pyoluteorin. Appl Environ Microbiol 61, 3856–3864.[Abstract]
Scholz-Schroeder, B. K., Soule, J. D. & Gross, D. C. (2003). The sypA, sypB and sypC synthetase genes encode twenty-two modules involved in the nonribosomal peptide synthesis of syringopeptin by Pseudomonas syringae pv. syringae B301D. Mol Plant Microbe Interact 16, 271–280.[Medline]
Sieber, S. A. & Marahiel, M. A. (2005). Molecular mechanisms underlying nonribosomal peptide synthesis: approaches to new antibiotics. Chem Rev 105, 715–738.[CrossRef][Medline]
Sørensen, D., Nielsen, T. H., Christophersen, C., Sørensen, J. & Gajhede, M. (2001). Cyclic lipoundecapeptide amphisin from Pseudomonas sp. strain DSS73. Acta Crystallogr C 57, 1123–1124.[Medline]
Stachelhaus, T., Mootz, H. D. & Marahiel, M. A. (1999). The specificity-conferring code of adenylation domains in nonribosomal peptide synthetases. Chem Biol 6, 493–505.[CrossRef][Medline]
Wolk, C. P., Cai, Y. & Panoff, J. M. (1991). Use of a transposon with luciferase as a reporter to identify environmentally responsive genes in a cyanobacterium. Proc Natl Acad Sci U S A 88, 5355–5359.
Yang, J., Hwang, J. S., Camakaris, H., Irawaty, W., Ishihama, A. & Pittard, J. (2004). Mode of action of the TyrR protein: repression and activation of the tyrP promoter of Escherichia coli. Mol Microbiol 52, 243–256.[CrossRef][Medline]
Received 4 January 2008;
revised 10 March 2008;
accepted 19 March 2008.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |