| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Genetics, Institute of Biology and Environmental Sciences, Carl von Ossietzky University Oldenburg, D-26111 Oldenburg, Germany
Correspondence
Wilfried Wackernagel
wilfried.wackernagel{at}uni-oldenburg.de
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
; Tønjum et al., 1995; de Vries et al., 2004), and it is a driving force both in the generation of diversity and for evolution (Arber, 2000). During natural transformation, a competent cell binds to a double-stranded DNA molecule, introduces a double-strand break, takes up the DNA, and transfers a single strand into the cytoplasm while the complementary strand is degraded (Dubnau & Provvedi, 2000; Chen & Dubnau, 2004). If the single strand is homologous to the cellular genome, it can be integrated by homologous recombination. The integration of foreign (non-homologous) DNA during transformation is possible if the foreign DNA is flanked by two segments that provide sequence homology to the recipient genome in which homologous recombination can occur. Foreign DNA having only a single small homologous segment can also be integrated through homology-facilitated illegitimate recombination (HFIR; de Vries & Wackernagel, 2002), which proceeds by homologous recombination in the homologous segment (anchor) accompanied by illegitimate recombination of the adjacent foreign DNA. HFIR was first observed in Streptococcus pneumoniae (Claverys et al., 1980), and was subsequently studied in detail in Gram-positive and Gram-negative bacteria, including S. pneumoniae (Prudhomme et al., 2002), Acinetobacter baylyi (de Vries & Wackernagel, 2002; de Vries et al., 2004; Harms et al., 2007; Hülter & Wackernagel, 2008) and Pseudomonas stutzeri (Meier & Wackernagel, 2003, 2005). In A. baylyi transformation, HFIR is about 10 000 times less frequent than fully homologous recombination, but at least 100 000-fold more frequent than integration of foreign DNA by illegitimate recombination in the absence of any homology (de Vries & Wackernagel, 2002; Hülter & Wackernagel, 2008).
Recently it was observed that homologous recombination during transformation of A. baylyi is influenced by RecBCD, resulting in fivefold decreased transformation by large chromosomal DNA fragments (
50 kb) and 3.3-fold increased transformation by a 1.5 kb PCR product (Kickstein et al., 2007). In Escherichia coli, the RecBCD enzyme is a central recombination enzyme having double-strand-specific DNase and helicase activities, of which the DNase activity is downregulated by specific octanucleotide sequences in DNA termed chi, in which a 3' single-stranded tail is loaded with RecA protein and initiates recombination (Kowalczykowski et al., 1994; Anderson & Kowalczykowski, 1997). The RecBCD enzyme is necessary for the recombinative repair of spontaneous broken replication forks (double-strand end repair) and DNA damage-induced double-strand breaks (DSBs), and for the genomic integration of homologous DNA transferred into the cell by transduction or conjugation (Kowalczykowski et al., 1994; Kuzminov, 1999). To explain the effect of a recBCD mutation on transformation of A. baylyi (and other transformable bacteria), it has been proposed that the genomic integration of the taken-up single strand occurs frequently by two temporally separated strand invasion and ligation processes for the 5' and 3' ends, which can lead to a DSB, e.g. when a nick is approached in the opposite strand or a replication fork runs through that region, and the DSB in turn will require RecBCD for repair (Kickstein et al., 2007). As in E. coli, a recD deletion mutant of A. baylyi probably retains the helicase activity of RecBCD, which is thought to act together with other DNases such as RecJ to mediate recombination. The recD mutant has the same transformation phenotype as the recBCD+ strain and is not impaired in UV survival and viability (Kickstein et al., 2007). The recD mutants of E. coli are also recombination proficient, fully viable and not UV sensitive (Amundsen et al., 1986; Kowalczykowski et al., 1994; Churchill et al., 1999; Kuzminov, 1999).
In E. coli, the effects of recB or recC mutations can be suppressed by additional mutations at both the sbcB (also termed xonA) and the sbcCD loci (Kushner et al., 1971, 1972; Lloyd & Buckman, 1985). The xonA gene encodes an exonuclease I (ExoI) specific for 3' DNA single strands (Lehman & Nussbaum, 1964). A corresponding gene is absent in A. baylyi (Barbe et al., 2004). The sbcC and sbcD genes in E. coli encode the subunits of the heterodimeric SbcCD enzyme, which is a single-stranded DNA endonuclease that cleaves DNA at double-strand/single-strand transitions and in branched structures, including hairpin loops and Y-shaped DNA, and which also has an ATP-dependent exonuclease activity (Connelly & Leach, 1996; Connelly et al., 1997, 1998, 1999). SbcC belongs to the superfamily of SMC (structural maintenance of the chromosome) proteins (Connelly et al., 1998) that operate in DNA repair and in genome maintenance and partition processes. Orthologues of SbcC and SbcD are present in many organisms from all three kingdoms of life (Sharples & Leach, 1995), including A. baylyi (Barbe et al., 2004). In the E. coli wild-type background, sbcC or sbcD mutations have no strong phenotype, whereas in Deinococcus radiodurans they cause reduced survival after gamma irradiation (Bentchikou et al., 2007). In Bacillus subtilis, the SbcCD complex is involved in DNA repair and is then mostly co-localized with the replication machinery (Mascarenhas et al., 2006).
Since RecBCD affects natural transformation in A. baylyi, we asked whether the enzyme also interfered with foreign DNA acquisition by HFIR. We found this to be the case, as HFIR was increased in a recBCD mutant. In A. baylyi the elimination of the genes similar to sbcC and sbcD of E. coli partially suppressed the UV sensitivity and low viability of a recBCD mutant and also lowered the increased HFIR frequency. In a recBCD+ background the sbcCD mutation increased HFIR frequency moderately and elevated homologous transformation with short but not long DNA fragments. How RecBCD and SbcCD interfere with HFIR events is discussed.
|
METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
. The A. baylyi strains JV28 (‘wild-type’) and its derivatives KOM18 (
recBCD) and EK6 (recD) have been described previously (de Vries et al., 2003; Kickstein et al., 2007). The strain KOM17 (sbcCD) was constructed by allelic exchange as described for the generation of the recBCD deletion strain (Kickstein et al., 2007). Briefly, DNA segments upstream (1052 bp) and downstream (992 bp) of the sbcD, sbcC genes of A. baylyi were amplified by PCR using the primer pairs sbcD-up-f (gtaaCAAGGCAGACAAGATCGGTTGC; lower case, non-homologous tail) and sbcD-up-r (atctagaGCTGATGAATTTCCTGTTTTTGATGAG; underlined, XbaI restriction site), and sbcC-down-f (cttctagaGCTCAAGTCGAATTGAAGTGGTCG) and sbcC-down-r (aacttGAGCTCAATCTCGCCATAAACCGTTG), respectively, and cloned into the plasmid vector pGT41 upstream and downstream of a gene cassette consisting of a selectable (nptII, kanamycin resistance, KmR) and counterselectable (sacB, sucrose sensitivity) marker pair, generating pKH80 with a sbcCD : : (nptII sacB) allele embedded into the natural flanking genomic regions. This DNA was used to naturally transform JV28, giving strain KOM12, which has the sbcCD operon substituted by the nptII sacB cassette. From pKH80, the nptII and sacB genes were removed by cleavage with XbaI, resulting in pKH81 with a sbcCD allele that was used to transform KOM12, giving strain KOM17 (sbcCD; sucrose resistant, kanamycin sensitive). The double mutant strain KOM45 (recBCD sbcCD) was constructed correspondingly by introduction of the recBCD : : (nptII sacB) allele into KOM17 by transformation with pKH83 and subsequent transformation of the resulting strain with pKH84, which contained the recBCD allele. The presence of deletions in strains was verified by PCR across the deletions and by PCR with internal primers for the deleted gene. Cloning of DNA fragments was carried out by standard procedures (Sambrook et al., 1989) using E. coli SF8 recA (Romanowski et al., 1993) as host strain. The bacterial strains were grown in LB medium (Sambrook et al., 1989) or in minimal medium, which was M9 (Sambrook et al., 1989) with 20 mM succinate (pH 7.5) as carbon source at 30 °C unless indicated otherwise. If applicable, the media contained the antibiotics ampicillin (Ap; 100 µg ml–1) or kanamycin (Km; 10 µg ml–1). The presence of the sacB gene was screened for by the inability of sacB+ strains to grow on medium containing sucrose (50 mg ml–1). PCR reactions were carried out with Phusion polymerase (Finnzymes) for cloning steps or for templates larger than 2 kb, or with Taq polymerase (Molzym) for other templates, according to the manufacturers' instructions. When Phusion was used, DMSO (10 %) was included in the assays.
|
). A. baylyi was grown in LB broth at 30 °C to 1x109 cells ml–1 and frozen in concentrated (1x1010 cells ml–1) aliquots in LB with 20 % glycerol (v/v) at –80 °C until use. For the transformation assay a freshly thawed bacterial suspension was diluted to 2.5x108 cells ml–1 in 1–10 ml LB with donor DNA (100 ng ml–1), aerated for 90 min, and plated on M9 or LB medium containing appropriate antibiotics (to examine transformants) and on LB medium (to determine c.f.u.). Colonies were counted after 16–40 h at 30 °C. Transformation frequencies are given as transformants per c.f.u. determined in each experiment. In transformation experiments with linearized plasmid DNA, a few transformants that had formed by cointegration of reconstituted plasmid DNA molecules (resulting from rare non-cleaved plasmid donor DNA) were identified by their Ap resistance (which was screened for subsequently to the selection of transformants on Km medium). These transformants (less than 10 % of the total) were not considered in the calculation of HFIR frequencies and were excluded from the analyses.
Characterization of HFIR transformants.
The locations of illegitimate fusion sites in HFIR transformants were determined by PCR amplification of the region using primer F1 (ATTCGCAGCGCATCGCCTTC) as forward primer and R5 (CTGAATGTCGTTGTAACTGG) or R9 (GATGGCGTACAGCTACTTGG) as reverse primer, and sequencing of the PCR products as reported previously (Harms et al., 2007). Each transformant came from a small separate transformation experiment to ensure that independent transformants were examined.
UV irradiation.
Cells were grown in LB exponentially to 2x108 cells ml–1 and resuspended in phosphate buffer at the same titre. Aliquots were exposed to UV light with stirring, as described by Thoms & Wackernagel (1982). The dose rate was 1.8 J m–2 s–1. Cells were plated after appropriate dilution on LB and counted after incubation for 24 h at 30 °C in the dark.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
). When these strains were transformed by ScaI-linearized pBlue-Km1 plasmid DNA containing a complete nptII gene (nptII+) followed by DNA heterologous to tg4 and the genomic sequence, KmR transformants could only form by HFIR (Fig. 1a). In the recBCD mutant the frequency of HFIR transformants was 6.9-fold higher than in the wild-type (Fig. 1a). The increased HFIR frequency indicated that the RecBCD enzyme suppresses HFIR in the wild-type.
|
). In the recBCD strain, the frequency was 3.4-fold higher than in the wild-type, confirming that RecBCD interferes with transformation by short homologous DNA fragments (Kickstein et al., 2007), which were present here as plasmid DNA fragments (5.2 kb). In contrast, when the homologous nptII+ tg4 cassette was present in large chromosomal donor DNA fragments [DNA isolated from strain JV28-KmR carrying a genomic alkM : : (nptII+ tg4) fusion; Table 1], the KmR transformation frequency of recBCD cells was twofold lower than that of wild-type cells (Fig. 1b). In previous experiments the recBCD mutation decreased transformation more strongly with chromosomal trp+ DNA (fivefold; Kickstein et al., 2007). We confirmed the stronger effect with genomic DNA fragments carrying a bla (Ap-resistance) gene inserted in the benK gene giving Ap-resistant transformants fivefold less frequently in recBCD [6.4(±6.0)x10–4] than in wild-type [3.1(±0.8)x10–3]. Other experiments with chromosomal donor DNAs gave 7.5-fold [ACIAD2185 : : nptII; 4.2(±0.4)x10–3 in wild-type, 6.4(±1.0)x10–4 in recBCD] and 10-fold decreases [recO : : (nptII sacB); 4.4(±1.3)x10–3 in wild-type, 4.4(±1.8)x10–4 in recBCD]. The reason for the relatively weak effect of recBCD deficiency on transformation with the alkM : : (nptII' tg4) cassette compared to the four other markers is not known.
In a recD mutant (strain EK6) the HFIR transformation frequency was identical to that in the wild-type (Fig. 1a) and also homologous transformation was not different (Fig. 1b), suggesting that the RecBC(D–) enzyme, perhaps in cooperation with other DNases, acts similarly to the RecBCD enzyme in both HFIR and homologous transformation.
More foreign DNA is integrated per HFIR event in the recBCD mutant
Illegitimate fusion sites identified in 22 independent HFIR transformants (each taken from a separate transformation experiment) of the recBCD mutant were dispersed over the entire heterologous donor DNA and the corresponding recipient region (Fig. 2a). The sites were somewhat shifted away from the anchor region compared to the fusion-site pattern observed in the wild-type, which involved the same nucleotide sequences in donor and recipient DNA (Fig. 2c; Harms et al., 2007). The mean length of foreign DNA integrated per event in the recBCD mutant was 1118 nt, which was significantly higher than the 682 nt integrated in the wild-type (significant at the 5 % level; Mann–Whitney U test; P=0.032). The mean length of deleted recipient DNA was 1107 nt, which was not significantly different from the 732 nt in the wild-type (P=0.1). The recBCD mutation led to 11-fold higher foreign DNA acquisition compared to wild-type (Table 2). The molecular characteristics of the illegitimate fusion sites in the recBCD mutant, including the mean length of microhomologies (8 nt), their GC contents (58 %) and the free energy of hybridization [–17 kcal mol–1 (–71.13 kJ mol–1); Harms et al., 2007], were not different from those of the sites in the wild-type [8 nt, 57 %, and –14.3 kcal mol–1 (–59.83 kJ mol–1), respectively; Harms et al., 2007].
|
|
). The deduced amino acid sequences of SbcC and SbcD have 28 and 30 % identity overall (44 and 46 % similarity), respectively, with the corresponding proteins of E. coli. An sbcCD deletion mutant of A. baylyi was constructed (KOM17), and with this strain HFIR transformants were obtained at a significantly higher (3.8-fold) frequency than with the wild-type (Fig. 1a), suggesting that about 74 % of HFIR events were eliminated in the wild-type by the SbcCD DNase. The distribution of illegitimate fusion sites in 22 independent transformants of the sbcCD mutant (Fig. 2b) did not differ discernibly from that found in the wild-type. On average, 821 nt were integrated per HFIR event in the sbcCD mutant, so that foreign DNA acquisition by HFIR was 4.5-fold higher compared to wild-type (Table 2). As with the transformants of the recBCD mutant, the fusion-site characteristics of sbcCD transformants were similar to those of the wild-type (data not shown).
Transformation with short homologous DNA molecules is increased in the sbcCD mutant
In vitro the SbcCD DNase has been shown to cleave branched molecules (Connelly & Leach, 1996; Connelly et al., 1997, 1998, 1999). Such structures could form during transformation after invasion of the donor single strand into the recipient DNA. The KmR transformation frequency of the sbcCD mutant with large chromosomal DNA containing the alkM : : (nptII+ tg4) cassette from strain JV28-KmR was about as high as that of the wild-type (Fig. 1b). Similar results were obtained in trp+ transformation experiments with chromosomal DNA [2.0(±1.3)x10–3 in sbcCD and 2.0(±1.4)x10–3 in wild-type], whereas with the small DNA molecules of the linearized plasmid pBlue-Km-tg4, the sbcCD strain gave a significantly higher (3.2-fold) KmR transformation frequency than the wild-type (Fig. 1b). This result was confirmed by the significantly (3.9-fold) higher trp+ transformation frequency in sbcCD [2.3(±1.2)x10–3] compared to wild-type [5.9(±1.2)x10–4] with the 1.5 kbp trp+ PCR product (t test; P<0.01). The sbcCD mutant showed the same generation time during exponential growth as the wild-type (46 min) and had full UV repair capacity (Fig. 3).
|
).
We also observed a suppression of the effects of the recBCD mutation on HFIR by the sbcCD deletion, as the 6.9-fold higher HFIR frequency of the recBCD mutant compared to the wild-type was lowered by the sbcCD mutation to a level 3.8-fold higher than that of the wild-type (Fig. 1a). Also, the 3.4-fold increased homologous transformation of the recBCD mutant strain with linearized plasmid DNA was reduced by approximately one-half to 1.8, and the twofold lower transformation by chromosomal DNA was brought back to the wild-type level by the sbcCD mutation (Fig. 1b). The wild-type-like homologous recombination frequencies were confirmed by transformation with the 1.5 kb trp+ PCR product and chromosomal trp+ DNA (data not shown).
As an unexpected side effect, the recBCD sbcCD mutant, which grew normally at 30 °C in both solid and liquid media, was found to be cold sensitive for growth on LB medium as colony formation dropped to about 0.3 % at 20 °C (wild-type: 100 %). The cold sensitivity appeared when a recBCD mutation was crossed into an sbcCD strain and vice versa. The survivors at 20 °C gave identical c.f.u. values at 30 and 20 °C, indicating that they were cold-resistant mutants.
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
), this result was intriguing. The increased HFIR frequency suggests that at least 85 % of potential HFIR events pass through a RecBCD-sensitive DNA intermediate. The increased HFIR frequency resembled the higher homologous transformation frequency of the recBCD mutant, with relatively short DNA fragments (PCR products or inserts of plasmids) compared to wild-type (Kickstein et al., 2007). The transformation-inhibiting effect of the functional RecBCD enzyme has been explained by genetic marker degradation when the enzyme resects a duplex DNA end during DSB repair to the next chi site at which recombination can initiate (Kowalczykowski et al., 1994). It is thought that DSBs can occur during transformation when only one end of the transforming DNA strand is ligated to resident DNA and a nick is approached in the opposite strand or replication runs through that region (Kickstein et al., 2007). When the transforming DNA molecules are short, resection would frequently destroy the marker or the heterologous DNA end in the course of HFIR, particularly since heterologous DNA would not be protected by a cognate chi site for the RecBCD enzyme of A. baylyi (Kowalczykowski et al., 1994). In recBCD mutants duplex DNA ends persist longer (Kowalczykowski et al., 1994). It is proposed that in A. baylyi persisting duplex DNA ends can undergo a RecBCD-independent repair, which would act on homologous and, less efficiently, on heterologous ends (Fig. 1). The observation that the integrated foreign DNA segments are 1.6-fold longer in the recBCD mutant than in the wild-type is in accord with this model (Table 2).
The above considerations have the implication that the majority of HFIR transformants in the recBCD mutant were not formed by direct single-strand integration as previously proposed (de Vries & Wackernagel, 2002) but by repair of duplex DNA ends independently of RecBCD. The repair could be similar to that acting in E. coli whereby replication blockage elicits a DSB and the restoration of the replication fork proceeds via a microhomology-dependent deletion formation (Bierne et al., 1997). The pathway termed the single-strand annealing repair pathway was proposed to rely on the annealing of a single-stranded overhang at the broken arm with a microhomology in the non-broken molecule. If the microhomology is located ahead of the primary break site, a new replication fork structure is formed at the expense of a deletion (Bierne et al., 1997). Repair with deletion formation increases 15-fold in cells devoid of the nucleolytic activity of the RecBCD enzyme (recD), indicating that the extended persistance of the broken DNA arm increases its chance to enter into the single-strand annealing repair pathway (Bierne et al., 1997). Accordingly, a recBCD mutation would increase (the microhomology-dependent) HFIR in A. baylyi, as was observed. However, a recD deletion strain did not (Fig. 1), suggesting a different situation in recD mutants of E. coli and A. baylyi. Possibly, in A. baylyi the action of the RecBC(D)– helicase together with that of other exonucleases removes approximately similar amounts of DNA from duplex DNA ends during attempted recombination repair, in the same way as the RecBCD enzyme, which frequently leads to marker loss. In fact, the phenotype of the recD mutant of A. baylyi with respect to transformation with short and long homologous DNA as well as HFIR transformation was indistinguishable from that of recBCD+ cells (Kickstein et al., 2007; Fig. 1). Recently, the microhomology-dependent single-strand annealing mechanism has also been proposed to cause the illegitimate recombination between prophage DNA and host genome during the formation of bio-transducing phage lambda in E. coli (Shiraishi et al., 2005).
The increased HFIR transformation and increased transformation with short homologous donor DNA in the sbcCD mutant can be related to the absence of single-strand cleavage in branched structures such as those formed during strand invasion, which is normally performed by the SbcCD DNase in the wild-type (Connelly et al., 1998, 1999). Cleavage at the branch would lead to the loss of a potential transformant if the genetic marker is located on the cleaved-off single strand, regardless of whether that part consists of homologous DNA (as in homologous transformation) or heterologous DNA (as in HFIR transformation). With long homologous donor DNA, the cleaved-off large DNA fragment can engage in a subsequent integration process in which it has a further chance to escape SbcCD. This would explain why the sbcCD mutation does not have a strong effect on the transformation with chromosomal DNA (compared to the sbcCD mutant the transformation frequency of the wild-type with chromosomal DNA was about 0.7; Fig. 1b).
The sbcCD mutation decreased the high HFIR level seen in the recBCD strain to the lower level of the sbcCD strain, acting like a phenotype suppressor. The decreased HFIR frequency of the double mutant was unexpected. We can speculate that the HFIR transformants that occur in the sbcCD strain and the recBCD sbcCD strain were not formed principally by the repair of transformation-induced DSB but by the initially proposed single-strand integration process (de Vries & Wackernagel, 2002), and that this process is no longer counteracted by the branch-cleaving activity of SbcCD, thus leading to increased HFIR frequencies. At the same time, the many HFIR transformants observed in the recBCD single mutant are possibly not formed in the recBCD sbcCD strain, perhaps because SbcCD is required for their generation in the single-strand annealing pathway, e.g. through the processing of the annealed strands at the microhomology into ligatable structures by trimming of the non-annealed single-strand tails. The double mutant was also peculiar in its cold-sensitive phenotype. Cold sensitivity has been observed previously in mutants of E. coli lacking the four single-strand DNases ExoI, ExoVII, ExoX and RecJ (Burdett et al., 2001), or ExoI, ExoVII, RecJ and SbcCD (Thoms et al., 2008). Inactivation of one of the mismatch repair (MMR) genes restores growth at low temperature to the E. coli quadruple single-strand DNase mutants (Burdett et al., 2001; Thoms et al., 2008). In the A. baylyi recBCD sbcCD mutant, the introduction of the mutS : : nptII allele did not restore growth at 20 °C, suggesting that the cold sensitivity is not related to the unsuccessful processing of intermediates of MMR or to hampered recovery from attempted MMR (Burdett et al., 2001).
Taken together, the results indicate that the activities of both RecBCD and SbcCD suppress foreign DNA acquisition, presumably by degradation of intermediate DNA structures in the HFIR process. A corresponding conclusion was recently drawn when a 20-fold increased HFIR frequency was observed in a recJ mutant (Harms et al., 2007). In that mutant increased numbers, specifically of small 5' heterologous DNA fragments, were integrated by HFIR, indicating that in the wild-type the 5' single-strand-specific RecJ exonuclease effectively degrades heterologous whiskers post-synaptically before they undergo illegitimate strand joining. The data presented in this report may also suggest that HFIR transformants arise by different pathways that are differently affected by RecBCD and SbcCD.
|
ACKNOWLEDGEMENTS |
|---|
Edited by: A. Holmes
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
Anderson, D. G. & Kowalczykowski, S. C. (1997). The translocating RecBCD enzyme stimulates recombination by directing RecA protein onto ssDNA in a chi-regulated manner. Cell 90, 77–86.[CrossRef][Medline]
Arber, W. (2000). Genetic variation: molecular mechanisms and impact on microbial evolution. FEMS Microbiol Rev 24, 1–7.[CrossRef][Medline]
Barbe, V., Vallenet, D., Fonknechten, N., Kreimeyer, A., Oztas, S., Labarre, L., Cruveiller, S., Robert, C., Duprat, S. & other authors (2004). Unique features revealed by the genome sequence of Acinetobacter sp. ADP1, a versatile and naturally transformation competent bacterium. Nucleic Acids Res 32, 5766–5779.
Bentchikou, E., Servant, P., Coste, G. & Sommer, S. (2007). Additive effects of SbcCD and PolX deficiencies in the in vivo repair of DNA double-strand breaks in Deinococcus radiodurans. J Bacteriol 189, 4784–4790.
Bierne, H., Ehrlich, S. D. & Michel, B. (1997). Deletions at stalled replication forks occur by two different pathways. EMBO J 16, 3332–3340.[CrossRef][Medline]
Burdett, V., Baitinger, C., Viswanathan, M., Lovett, S. T. & Modrich, P. (2001). In vivo requirement for RecJ, ExoVII, ExoI, and ExoX in methyl-directed mismatch repair. Proc Natl Acad Sci U S A 98, 6765–6770.
Chen, I. & Dubnau, D. (2004). DNA uptake during bacterial transformation. Nat Rev Microbiol 2, 241–249.[CrossRef][Medline]
Churchill, J. J., Anderson, D. G. & Kowalczykowski, S. C. (1999). The RecBC enzyme loads RecA protein onto ssDNA asymmetrically and independently of chi, resulting in constitutive recombination activation. Genes Dev 13, 901–911.
Claverys, J. P., Lefevre, J. C. & Sicard, A. M. (1980). Transformation of Streptococcus pneumoniae with S. pneumoniae-lambda phage hybrid DNA: induction of deletions. Proc Natl Acad Sci U S A 77, 3534–3538.
Connelly, J. C. & Leach, D. R. (1996). The sbcC and sbcD genes of Escherichia coli encode a nuclease involved in palindrome inviability and genetic recombination. Genes Cells 1, 285–291.[Abstract]
Connelly, J. C., de Leau, E. S., Okely, E. A. & Leach, D. R. (1997). Overexpression, purification, and characterization of the SbcCD protein from Escherichia coli. J Biol Chem 272, 19819–19826.
Connelly, J. C., Kirkham, L. A. & Leach, D. R. (1998). The SbcCD nuclease of Escherichia coli is a structural maintenance of chromosomes (SMC) family protein that cleaves hairpin DNA. Proc Natl Acad Sci U S A 95, 7969–7974.
Connelly, J. C., de Leau, E. S. & Leach, D. R. (1999). DNA cleavage and degradation by the SbcCD protein complex from Escherichia coli. Nucleic Acids Res 27, 1039–1046.
de Vries, J. & Wackernagel, W. (1998). Detection of nptII (kanamycin resistance) genes in genomes of transgenic plants by marker rescue transformation. Mol Gen Genet 257, 606–613.[CrossRef][Medline]
de Vries, J. & Wackernagel, W. (2002). Integration of foreign DNA during natural transformation of Acinetobacter sp. by homology-facilitated illegitimate recombination. Proc Natl Acad Sci U S A 99, 2094–2099.
de Vries, J., Heine, M., Harms, K. & Wackernagel, W. (2003). Spread of recombinant DNA by roots and pollen of transgenic potato plants, identified by highly specific biomonitoring using natural transformation of Acinetobacter sp. Appl Environ Microbiol 69, 4455–4462.
de Vries, J., Herzfeld, T. & Wackernagel, W. (2004). Transfer of plastid DNA from tobacco to the soil bacterium Acinetobacter sp. by natural transformation. Mol Microbiol 53, 323–334.[CrossRef][Medline]
Dubnau, D. & Provvedi, R. (2000). Internalizing DNA. Res Microbiol 151, 475–480.[Medline]
Harms, K., Schön, V., Kickstein, E. & Wackernagel, W. (2007). The RecJ DNase strongly suppresses genomic integration of short but not long DNA fragments by homology-facilitated illegitimate recombination during transformation of Acinetobacter baylyi. Mol Microbiol 64, 691–702.[CrossRef][Medline]
Hülter, N. & Wackernagel, W. (2008). Double illegitimate recombination events integrate DNA segments through two different mechanisms during natural transformation of Acinetobacter baylyi. Mol Microbiol 67, 984–995.[CrossRef][Medline]
Kickstein, E., Harms, K. & Wackernagel, W. (2007). Deletions of recBCD and recD influence genetic transformation differently and are lethal together with a recJ deletion in Acinetobacter baylyi. Microbiology 153, 2259–2270.
Kowalczykowski, S. C., Dixon, D. A., Eggleston, A. K., Lauder, S. D. & Rehrauer, W. M. (1994). Biochemistry of homologous recombination in Escherichia coli. Microbiol Rev 58, 401–465.
Kushner, S. R., Nagaishi, H., Templin, A. & Clark, A. J. (1971). Genetic recombination in Escherichia coli: the role of exonuclease I. Proc Natl Acad Sci U S A 68, 824–827.
Kushner, S. R., Nagaishi, H. & Clark, A. J. (1972). Indirect suppression of recB and recC mutations by exonuclease I deficiency. Proc Natl Acad Sci U S A 69, 1366–1370.
Kuzminov, A. (1999). Recombinational repair of DNA damage in Escherichia coli and bacteriophage lambda. Microbiol Mol Biol Rev 63, 751–813.
Lehman, I. R. & Nussbaum, A. L. (1964). The deoxyribonucleases of Escherichia coli. V. On the specificity of exonuclease I (phosphodiesterase). J Biol Chem 239, 2628–2636.
Lloyd, R. G. & Buckman, C. (1985). Identification and genetic analysis of sbcC mutations in commonly used recBC sbcB strains of Escherichia coli K-12. J Bacteriol 164, 836–844.
Lorenz, M. G. & Wackernagel, W. (1994). Bacterial gene transfer by natural genetic transformation in the environment. Microbiol Rev 58, 563–602.
Mascarenhas, J., Sanchez, H., Tadesse, S., Kidane, D., Krisnamurthy, M., Alonso, J. C. & Graumann, P. L. (2006). Bacillus subtilis SbcC protein plays an important role in DNA inter-strand cross-link repair. BMC Mol Biol 7, 20[CrossRef][Medline]
Meier, P. & Wackernagel, W. (2003). Mechanisms of homology-facilitated illegitimate recombination for foreign DNA acquisition in transformable Pseudomonas stutzeri. Mol Microbiol 48, 1107–1118.[CrossRef][Medline]
Meier, P. & Wackernagel, W. (2005). Impact of mutS inactivation on foreign DNA acquisition by natural transformation in Pseudomonas stutzeri. J Bacteriol 187, 143–154.
Prudhomme, M., Libante, V. & Claverys, J. P. (2002). Homologous recombination at the border: insertion-deletions and the trapping of foreign DNA in Streptococcus pneumoniae. Proc Natl Acad Sci U S A 99, 2100–2105.
Romanowski, G., Lorenz, M. G. & Wackernagel, W. (1993). Use of polymerase chain reaction and electroporation of Escherichia coli to monitor the persistence of extracellular plasmid DNA introduced into natural soils. Appl Environ Microbiol 59, 3438–3446.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Sharples, G. J. & Leach, D. R. (1995). Structural and functional similarities between the SbcCD proteins of Escherichia coli and the RAD50 and MRE11 (RAD32) recombination and repair proteins of yeast. Mol Microbiol 17, 1215–1217.[CrossRef][Medline]
Shiraishi, K., Imai, Y., Yoshizaki, S. & Ikeda, H. (2005). Rep helicase suppresses short-homology-dependent illegitimate recombination in Escherichia coli. Genes Cells 10, 1015–1023.
Thoms, B. & Wackernagel, W. (1982). UV-induced alleviation of lambda restriction in Escherichia coli K-12: kinetics of induction and specificity of this SOS function. Mol Gen Genet 186, 111–117.[CrossRef][Medline]
Thoms, B., Borchers, I. & Wackernagel, W. (2008). Effects of single-strand DNases ExoI, RecJ, ExoVII, and SbcCD on homologous recombination of recBCD+ strains of Escherichia coli and roles of SbcB15 and XonA2 mutant enzymes of ExoI. J Bacteriol 190, 179–192.
Tønjum, T., Higgins, J. D. & Gibson, T. J. (1995). Fastidious Gram-negative bacteria: meeting the diagnostic challenge with nucleic acid analysis. APMIS 103, 609–627.[Medline]
Received 11 March 2008;
revised 8 May 2008;
accepted 13 May 2008.
This article has been cited by other articles:
|
|
 |
|
  J. L. Ray, K. Harms, O.-G. Wikmark, I. Starikova, P. J. Johnsen, and K. M. Nielsen Sexual Isolation in Acinetobacter baylyi Is Locus-Specific and Varies 10,000-Fold Over the Genome Genetics, August 1, 2009; 182(4): 1165 - 1181. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Hulter and W. Wackernagel Frequent integration of short homologous DNA tracks during Acinetobacter baylyi transformation and influence of transcription and RecJ and SbcCD DNases Microbiology, December 1, 2008; 154(12): 3676 - 3685. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |
); KOM17, 
); KOM18, 
); KOM45, 
). Data are means from three to four independent experiments; error bars, 1 SD.