Microbiology Publish Ahead of Print

Metabolism of conjugated linoleic acids and 18:1 fatty acids by ruminal bacteria: products and mechanisms [PHYSIOLOGY AND BIOCHEMISTRY]

McKain, N., Shingfield, K. J, Wallace, R J. — Thu, 19 Nov 2009 04:31:16 PST

Cultures of ruminal bacteria known to metabolize unsaturated fatty acids were grown in medium containing 50 µg/ml of geometric and positional isomers of conjugated linoleic acid (CLA) or 18:1 fatty acids and 37.4% deuterium oxide to investigate the mechanisms responsible for fatty acid metabolism. Butyrivibrio fibrisolvens JW11 converted cis-9,trans-11-18:2 and trans-9,trans-11-18:2 to trans-11-18:1 as the main product, labelled at C-9, and metabolized trans-10,cis-12-18:2 to trans-10-18:1, labelled at C-13, and smaller amounts of trans-12-18:1 and cis-12-18:1. Butyrivibrio proteoclasticus P-18 did not grow in the presence of cis-9,trans-11-18:2 or trans-10,cis-12-18:2, but grew in medium containing trans-9,trans-11-18:2, forming 18:0. Propionibacterium acnes, a ruminal species that isomerizes linoleic acid to trans-10,cis-12-18:2, did not metabolize CLA isomers further. B. fibrisolvens metabolized small amounts of trans-10-18:1, trans-11-18:1 and cis-9-18:1, but the products formed were not detected. B. proteoclasticus, on the other hand, carried out substantial conversion of 18:1 substrates to 18:0. P. acnes hydrated cis-9-18:1 and trans-11-18:1 to 10-OH-18:0, which was further oxidized to yield 10-O-18:0. The deuterium enrichment in the intermediates formed during incubations with 9,11 geometric isomers of CLA was about half that of the products from trans-10,cis-12 CLA and 18:1 isomers, suggesting that the reduction of 9,11 geometric isomers CLA by ruminal bacteria occurs via different mechanisms compared with the metabolism of other unsaturated fatty acids.

Early intracellular trafficking of Waddlia chondrophila in human macrophages [CELL AND MOLECULAR BIOLOGY OF MICROBES]

Croxatto, A., Greub, G. — Thu, 19 Nov 2009 04:31:14 PST

Waddlia chondrophila is a strict intracellular bacterium considered as a potential agent of abortion in both humans and bovines. This member of the Chlamydiales order multiplies rapidly within human macrophages and induces lysis of the infected cells. To understand how this Chlamydia-like microorganism invades and proliferates within host cells, we investigated its trafficking within monocyte-derived human macrophages. Vacuoles containing Waddlia acquired the early endosomal marker EEA1 during the first 30 minutes following uptake. However, the live Waddlia-containing vacuoles never co-localised with late endosome and lysosome markers. Instead of interacting with the endosomal pathway, Waddlia immediately co-localised with mitochondria and shortly after with endoplasmic reticulum (ER) resident proteins such as calnexin and PDI. The acquisition of mitochondria and ER markers corresponds to the beginning of bacterial replication. Noteworthy, mitochondria recruitment to Waddlia inclusions is only prevented by simultaneous treatment with the microtubule and actin cytoskeleton disrupting agents Nocodazole and Cytochalasin D. In addition, Brefeldin A inhibits the replication of Waddlia supporting a role for COPI-dependent trafficking in the biogenesis of the bacterial replicating vacuole. W. chondrophila survives within human macrophages likely by evading the endocytic pathway and by associating with mitochondria and the ER. The intracellular trafficking of Waddlia in human macrophages represents a novel route that strongly differs from that used by other members of the Chlamydiales order.

Role of a RNA Polymerase Interacting Protein, MsRbpA, from Mycobacterium smegmatis in Phenotypic Tolerance Against Rifampicin [MICROBIAL PATHOGENICITY]

Dey, A., Verma, A. K., Chatterji, D. — Thu, 19 Nov 2009 04:31:16 PST

Rifampicin and its derivatives are at the forefront in the current standard chemotherapeutic regimen for active tuberculosis by inhibiting the transcription activity of prokaryotic RNA polymerase. Rifampicin is believed to interact with the β subunit of RNA polymerase. However, it has been observed that protein-protein interactions with RNA polymerase core enzyme leads to its reduced susceptibility towards rifampicin. This mechanism became more diversified with the discovery of RbpA, a novel RNA polymerase binding protein, in Streptomyces coelicolor which had the capability of mitigating the effect of rifampicin on RNA polymerase activity. MsRbpA is a homologue of RbpA in Mycobacterium smegmatis. On deciphering the role of MsRbpA in M. smegmatis we found that it interacts with RNA polymerase and increases the rifampicin tolerance levels, both in vitro and in vivo. It interacts with the β-subunit of RNA polymerase. However, it was found to be incapable of rescuing the rifampicin resistant RNA polymerases at their IC50 concentrations of rifampicin.

Crystal structure of the transcriptional repressor PagR of Bacillus anthracis [CELL AND MOLECULAR BIOLOGY OF MICROBES]

Zhao, H., Volkov, A., Veldore, V. H., Hoch, J. A., Varughese, K. I. — Thu, 19 Nov 2009 04:31:14 PST

PagR is a transcription repressor in Bacillus anthracis, that controls the chromosomal S-layer genes eag, sap and down-regulates the protective antigen pagA gene by direct binding to their promoter regions. The PagR protein sequence is similar to those of members of the ArsR repressor family involved in the repression of arsenate resistance genes in numerous bacteria. The crystal structure of PagR was solved using MAD techniques and was refined with 1.8Å resolution diffraction data. The PagR molecules form dimers as observed in all SmtB/ArsR repressor family of proteins. In the crystal lattice four PagR dimers pack together to form an inactive octamer. Model building studies suggest that the dimer binds to a DNA duplex with a bend of around 40º.

Genotyping of Mycobacterium avium complex organisms using Multispacer Sequence Typing [CELL AND MOLECULAR BIOLOGY OF MICROBES]

Cayrou, C., Turenne, C., Behr, M. A., Drancourt, M. — Thu, 19 Nov 2009 04:31:15 PST

Mycobacterium avium complex (MAC) comprises several species of environmental and animal-associated, slowing growing mycobacteria including Mycobacterium avium, Mycobacterium intracellulare, Mycobacterium chimaera, Mycobacterium colombiense, Mycobacterium arosiense, Mycobacterium bouchedurhonense, Mycobacterium marseillense, and Mycobacterium timonense. In humans, MAC organisms are responsible for opportunistic infections whose unique epidemiology remains poorly understood, in part due to the lack of a genotyping method applicable to all the eight MAC species. We herein developed multispacer sequence typing (MST), a sequencing-based method, for the genotyping of MAC organisms. An alignment of the genome sequence of M. avium subsp. hominissuis strain 104 and M. avium subsp. paratuberculosis strain K-10 revealed 621 intergenic spacers < 1,000-bp. From these 16 spacers were selected that ranged from 300-800-bp size and contained a number of variable bases <50 within each of the 16 spacers. Four spacers were successfully PCR-amplified and sequenced in 11 reference strains. Combining the sequence of these 4 spacers in 106 MAC organisms, including 83 M. avium, 11 M. intracellulare, 6 M. chimaera, 2 M. colombiense and one each of M. arosiense, M. bouchedurhonense, M. marseillense and M. timonense yielded a total of 45 spacer-types, with an index of discrimination of 0.94. Each spacer-type was specific for a species and certain spacer-types were specific for subspecies of M. avium. MST is a new method for genotyping of organisms belonging to any one of the eight MAC species tested in this study.

Different effects of transcriptional regulators marA, soxS, and rob on susceptibility of Escherichia coli to cationic antimicrobial peptides (CAMPs): Rob-dependent CAMP induction of the marRAB operon [MICROBIAL PATHOGENICITY]

Warner, D. M., Levy, S. B — Thu, 19 Nov 2009 04:31:17 PST

Cationic antimicrobial peptides (CAMPs), a component of the mammalian immune system, protect the host from bacterial infections. The roles of the Escherichia coli transcriptional regulators MarA, SoxS, and Rob in susceptibility to these peptides were examined. Overexpression of marA, either in an antibiotic resistant marR mutant or from a plasmid, decreased bacterial susceptibility to CAMPs. Overexpression of the soxRS locus from a plasmid, which decreased susceptibility to antibiotics, unexpectedly caused no decrease in CAMP susceptibility instead it produced increased susceptibility to different CAMPs. Deletion or overexpression of rob had little effect on CAMP susceptibility. The marRAB operon was upregulated when E. coli was incubated in sublethal amounts of CAMPs polymyxin B, LL-37, or human-β defensin-1; however, this upregulation required Rob. Deletion of acrA increased bacterial susceptibility to polymyxin B, LL-37, and human β defensin-1 peptides. Deletion of tolC yielded an even greater increase in susceptibility to these peptides and also displayed increased susceptibility to human defensin-2. Inhibition of cellular proton motive force energizing efflux pumps increased peptide susceptibility for wild type and acrA deletion strains; however, it decreased susceptibility of tolC mutants. These findings demonstrate that CAMPs are both inducers of marA-mediated drug resistance through interaction with Rob and are substrates for efflux in E. coli. The three related transcriptional regulators show different effects on bacterial cell susceptibility to CAMPs.

The Pseudomonas aeruginosa oxidative stress regulator OxyR influences pyocyanin and rhamnolipids production: protective role of pyocyanin [CELL AND MOLECULAR BIOLOGY OF MICROBES]

Vinckx, T., Wei, Q., Matthijs, S., Cornelis, P. — Thu, 19 Nov 2009 04:31:14 PST

The LysR-type transcriptional regulator (LTTR) OxyR orchestrates the defense of the opportunistic pathogen Pseudomonas aeruginosa against reactive oxygen species. In previous work we also demonstrated that OxyR is needed for the utilization of the ferrisiderophore pyoverdine, stressing the importance of this regulator. Here, we show that an oxyR mutant is unable to swarm on agar plates, probably as a consequence of absence of production of rhamnolipid surfactant molecules. Another obvious phenotypic change was the increased production of the phenazine redox molecule pyocyanin in the oxyR mutant. As already described, the oxyR mutant could not grow in LB medium, unless high numbers of cells (>108 ml-1) were inoculated. However, growth in Pseudomonas P agar (King's A), a medium inducing pyocyanin production was like wild type, suggesting a protective action of this redox phenazine compound. This was confirmed by the restoration of the capacity to grow in LB medium upon addition of pure pyocyanin. Although both rhamnolipids and pyocyanin production are controlled by quorum sensing, no obvious changes were observed in the production of N-acyl-homoserine lactones or the Pseudomonas quinolone signal (PQS). Complementation of rhamnolipid production, motility, and restoration of normal pyocyanin levels was only possible when the oxyR gene was in single copy while pyocyanin levels were increased when oxyR was present in a multicopy vector. Conversely, plating efficiency was increased only when the oxyR gene was present in multicopy, but not when in single copy in the chromosome, due to lower expression of oxyR compared with the wild-type, suggesting that some phenotypes are differently affected in function to the levels of OxyR molecules in the cell. Analysis of transcripts of oxidative stress response enzymes showed a strong decrease of katB, ahpC and ahpB expression in the oxyR mutant grown in LB, but this was not the case when the mutant was grown on P agar, suggesting that the OxyR dependency for the transcription of these genes is not total.

An RNA helicase, CrhR, regulates the low-temperature-inducible expression of three genes for molecular chaperones in Synechocystis sp. PCC 6803 [CELL AND MOLECULAR BIOLOGY OF MICROBES]

Thu, 19 Nov 2009 04:31:15 PST

Expression of the crhR gene for an RNA helicase, CrhR, is strongly induced when the cyanobacterium Synechocystis sp. PCC 6803 is exposed to a downward shift in ambient temperature. CrhR might be involved in the acclimation of cyanobacterial cells to low-temperature environments but its putative role during such acclimatization is unknown. In the present study, we replaced the crhR gene with a spectinomycin-resistance gene cassette. The resultant crhR cells grew more slowly than wild-type cells at low temperatures. DNA microarray analysis of the genome-wide expression of genes and Northern and Western blotting analyses indicated that such mutation of the crhR gene repressed the low-temperature-inducible expression of the chaperone-encoding heat-shock genes groEL1 and groEL2 at both the transcriptional and the translational level. The kinetics of changes in levels of the groESL transcript and the groEL2 transcript after addition of rifampicin suggested that CrhR might stabilize these transcripts during the early phase, namely, from 5 to 60 min after the start of acclimatization to low temperature, and enhanced the transcription of these genes two to four hours later, namely, at 3-5 h. Our results indicate that CrhR regulates the low-temperature-induced expression of these molecular chaperones, which, in turn, might be essential for acclimatization of Synechocystis cells to low temperatures.

Restricted cytosolic growth of Francisella tularensis subsp. tularensis by IFN-{gamma} activation of macrophages [MICROBIAL PATHOGENICITY]

Edwards, J. A, Rockx-Brouwer, D., Nair, V., Celli, J. — Thu, 19 Nov 2009 04:31:15 PST

The intracellular bacterium Francisella tularensis ensures its survival and proliferation within phagocytes of the infected host through phagosomal escape and cytosolic replication, to cause the disease tularemia. The cytokine interferon- (IFN-) is important to control primary infections in vivo and in vitro intracellular proliferation of Francisella in macrophages, but its actual effects on the bacterium's intracellular cycle are ambiguous. Here we have performed an extensive analysis of the intracellular fate of the virulent F. tularensis subsp. tularensis strain Schu S4 in primary IFN--activated murine and human macrophages to understand how this cytokine controls Francisella proliferation. In both murine bone marrow-derived macrophages (muBMMs) and human blood monocyte-derived macrophages (MDMs), IFN- controlled bacterial proliferation. Schu S4 growth inhibition was not due to a defect in phagosomal escape, since bacteria disrupted their phagosomes with indistinguishable kinetics in both muBMMs and MDMs, regardless of their activation state. Rather, IFN- activation restricted cytosolic replication of Schu S4 in a manner independent of reactive oxygen or nitrogen species. Hence, IFN- induces Phox- and iNOS-independent cytosolic effector mechanisms that restrict growth of virulent Francisella in macrophages.

Poly(A) polymerase 1 (PAP1) homozygosity and hyperadenylation are major determinants of increased mRNA stability of CDR1 in azole resistant clinical isolates of Candida albicans [CELL AND MOLECULAR BIOLOGY OF MICROBES]

Manoharlal, R., Gorantala, J., Sharma, M., Sanglard, D., Prasad, R. — Thu, 12 Nov 2009 04:01:10 PST

Using genetically matched azole-susceptible (AS) and azole-resistant (AR) clinical isolates of C. albicans, we recently demonstrated that CDR1 over-expression in AR isolates is due to its enhanced transcriptional activation and mRNA stability. This study examines the molecular mechanisms underlying enhanced CDR1 mRNA stability in AR isolates. Mapping of the 3'UTR of CDR1 revealed that it was rich in ‘AU’ (Adenylate-Uridylate) elements, possessed heterogeneous polyadenylation sites, and had putative consensus sequences for RNA-binding proteins. Swapping of heterologous and chimeric lacZ-CDR1 3'UTR transcriptional reporter fusion constructs did not alter the reporter activity in AS and AR isolates, indicating that cis-acting sequences within the CDR1 3'UTR itself are not sufficient to confer the observed differential mRNA decay. Interestingly, the poly(A) tail of the CDR1 mRNA of AR isolates was 35-50% hyperadenylated as compared with AS isolates. C. albicans poly(A) polymerase (PAP1) responsible for mRNA adenylation resides on chromosome 5 in close proximity to the MTL (Mating Type-Like) locus. Two different PAP1 alleles, i.e. PAP1-a/PAP1-, were recovered from AS (MTL-a/MTL-), while a single type of PAP1 allele (PAP1-) was recovered from AR isolates (MTL-/MTL-). Among the heterozygous deletions of PAP1-a (pap1-a/PAP1-) and PAP1- (PAP1-a/pap1-), only the former led to relative enhanced drug resistance, to polyadenylation and transcript stability of CDR1 in the AS isolate. This suggests a dominant negative role of PAP1-a on CDR1 transcript polyadenylation and stability. Taken together, our study provides the first evidence that loss of heterozygosity at the PAP1 locus is linked to hyperadenylation and subsequent increased stability of CDR1 transcripts, thus contributing to enhanced drug resistance.

Integrating Multiple "Omics" Analysis for Microbial Biology: Application and Methodologies [REVIEW]

Zhang, W., Li, F., Nie, L. — Thu, 12 Nov 2009 04:01:11 PST

Recent advances in various "omics" technologies enable quantitative monitoring of the abundance of various biological molecules in a high throughput manner, and thus allow determination of their variation between different biological states on a genomic scale. Several popular "omics" platforms that have been used in microbial systems biology include: transcriptomics that measures messenger RNA transcript levels, proteomics that quantifies protein abundance, metabolomics that determines abundance of small cellular metabolites, interactomics that resolves the whole set of molecular interactions in cells, and fluxomics that establishes dynamic changes of molecules within a cell over time. However, no single "omics" analysis can fully unravel the complexities of fundamental microbial biology. Therefore, integration of multiple layers of information, the multi-"omics" approach, is required to acquire a precise picture of living microorganisms. In spite of being a challenging task, some attempts were made recently to integrate heterogeneous "omics" datasets in various microbial systems and the results have demonstrated that multiple-omics approach is a powerful tool for understanding the functional principles and dynamics of total cellular systems. In the article, some basic concepts of various experimental "omics" approaches, recent application of the integrated "omics" for exploring metabolic and regulatory mechanisms in microbes, and advance of computational and statistical methodologies associated with integrated "omics" analyses are reviewed. In addition, online databases and bioinformatic infrastructure available for integrated "omics" analyses are also briefly discussed.

Analysis of adherence, biofilm formation, and cytotoxicity suggest a greater virulence potential of Gardnerella vaginalis relative to other bacterial vaginosis-associated anaerobes [MICROBIAL PATHOGENICITY]

Patterson, J. L, Stull-Lane, A., Girerd, P. H, Jefferson, K. K — Thu, 12 Nov 2009 04:01:10 PST

Worldwide, bacterial vaginosis (BV) is the most common vaginal disorder in women of childbearing age. BV is characterized by a dramatic shift in the vaginal microflora, involving a relative decrease in lactobacilli and a proliferation of anaerobes. In most BV cases, the predominant bacterial species found is Gardnerella vaginalis. However, pure cultures of G. vaginalis do not always result in BV and asymptomatic women are sometimes colonized with low numbers of G. vaginalis. Thus, there is controversy about whether G. vaginalis is an opportunistic pathogen and the causative agent of many cases of BV, or whether BV is a polymicrobial condition caused by the collective effects of an altered microbial flora. Recent studies of the biofilm-forming potential and cytotoxic activity of G. vaginalis have renewed interest in the virulence potential of this organism. In an effort to tease apart the etiology of this disorder, we utilized in vitro assays to compare three virulence properties of G. vaginalis relative to other BV-associated anaerobes. We designed a viable assay to analyze bacterial adherence to vaginal epithelial cells; we compared biofilm-producing capacities; and we assessed cytotoxic activity. Of the BV-associated anaerobes tested, only G. vaginalis demonstrated all three virulence properties combined. This study suggests that G. vaginalis is more virulent than other BV-associated anaerobes, and that many of the bacterial species frequently isolated from BV may be relatively avirulent opportunists that colonize the vagina after G. vaginalis has initiated an infection.

Autophagy is Involved in Starvation Response and Cell Death in Blastocystis [CELL AND MOLECULAR BIOLOGY OF MICROBES]

Yin, J., Ye, A. J., Tan, K. S. — Thu, 12 Nov 2009 04:01:09 PST

Previous studies demonstrated that colony forms of Blastocystis undergo cell death with numerous membrane-bound vesicles containing organelles located within the central vacuole, resembling morphological features of autophagy. In this study, we investigated if Blastocystis underwent autophagy upon amino acid starvation and rapamycin treatment. Concurrently, we have provided new insight on a possible function of the central vacuole. The use of autophagic marker monodansylcadaverine (MDC) and autophagic inhibitor 3-methyladenine and wortmannin showed the existence of autophagy in amino acid-starved and rapamycin-treated Blastocystis. Confocal microscopy and transmission electron microscopic studies also showed morphological changes suggestive of autophagy. The unusually large size of the autophagic compartments within the parasite central vacuole was found to be unique in Blastocystis. In addition, autophagy was found to be triggered when cells were exposed to a cytotoxic antibody MAb 1D5 and intensified in the presence of caspase inhibitor zVAD.fmk. Taken together, our results suggest that the core machinery for autophagy is conserved in Blastocystis and plays an important role in starvation response and cell death of the parasite.

A 2-oxoacid dehydrogenase complex of Haloferax volcanii is essential for growth on isoleucine but not the other branched chain amino acids [GENES AND GENOMES]

Sisignano, M., Morbitzer, D., Gagens, J., Oldiges, M., Soppa, J. — Thu, 12 Nov 2009 04:01:09 PST

The halophilic archaeon Haloferax volcanii contains three operons encoding 2-oxoacid dehydrogenase complexes (OADHCs), OADHC1 to OADHC3. However, the biological role of none of the three OADHCs is known, since previous studies had come to the conclusion that they cannot use any of the known OADHC substrates. Even the construction of single mutants in all three oadhc operons, reported recently, could not lead to the identification of a substrate. Therefore, all three possible double mutants and a triple mutant were generated, and single, double and triple mutants were compared to the wildtype. The four mutants devoid of a functional OADHC1 had a reduced growth yield during nitrate-respirative growth on tryptone. A "metabolome analysis" of the medium after growth of the triple mutant in comparison to the wildtype revealed that the former was unable to degrade isoleucine and leucine, in contrast to the latter. It was revealed that the oadhc1 mutants were unable to grow in synthetic medium on isoleucine, in contrast to the other mutants and the isogenic parent strain. However, all strains grew indistinguishably on the other branched chain amino acids, valine and leucine. The transcript of the oadhc1 operon was highly induced during growth on isoleucine. However, attempts to detect an enzymatic activity were unsuccessful, while the branched chain OADHC (BCDHC) of Pseudomonas putida could easily be measured. Therefore, the growth capability of the triple mutant and the wildtype on the two first degradation intermediates of isoleucine was tested and provided further evidence that OADHC is involved in isoleucine degradation. Taken together, the results indicate that OADHC1 is a specialized BCDHC that uses only one (or maximally two) of the three branched chain 2-oxoacids, in contrast to BCDHCs from other species.

Role of Host Cell Polarity and Leading Edge Properties in Pseudomonas Type III Secretion [MICROBIAL PATHOGENICITY]

Bridge, D. R, Novotny, M. J, Moore, E. R, Olson, J. C — Thu, 12 Nov 2009 04:01:08 PST

Type III secretion (T3S) functions in establishing infections in a large number of Gram-negative bacteria, yet little is known about how host cell properties might function in this process. We used the opportunistic pathogen, Pseudomonas aeruginosa, and the ability to alter host cell sensitivity to Pseudomonas T3S to explore this problem. HT-29 epithelial cells were used to study cellular changes associated with loss of T3S sensitivity, which could be induced by treatment with methyl-beta-cyclodextrin or perfringolysin O. HL-60 promyelocytic cells are innately resistant to Pseudomonas T3S and were used to study cellular changes occurring in response to induction of T3S sensitivity, which occurred following treatment with phorbol esters. Using both cell models, a positive correlation was observed between eukaryotic cell adherence to tissue culture wells and T3S sensitivity. In examining the type of adhesion process linked to T3S sensitivity in HT-29 cells, a hierarchal order of protein involvement was identified that paralleled the architecture of leading edge focal complexes. Conversely, in HL-60 cells induction of T3S sensitivity coincided with the onset of leading edge properties and the development of actin-rich projections associated with polarized cell migration. When leading edge architecture was examined by immunofluorescent staining for actin, Rac1, IQGAP1 and PI3 kinase, intact leading edge structure was found to closely correlate with host cell sensitivity to Pa-T3S. Our model for host cell involvement in Pseudomonas T3S proposes that cortical actin polymerization at the leading edge alters membrane properties to favor T3S translocon function and the establishment of infections, which is consistent with Pseudomonas infections targeting wounded epithelial barriers undergoing cell migration.

From spores to antibiotics via the cell cycle [SGM SPECIAL LECTURES]

Errington, J. — Thu, 05 Nov 2009 04:01:10 PST

Spore formation in Bacillus subtilis is a superb experimental system with which to study some of the most fundamental problems of cellular development and differentiation. Work begun in the 1980's and ongoing today has led to an impressive understanding of the temporal and spatial regulation of sporulation, and the functions of many of the several hundred genes involved. Early in sporulation the cells divide in an unusual asymmetric manner, to produce a small prespore cell and a much larger mother cell. Aside from developmental biology, this modified division has turned out to be a powerful system for investigation of cell cycle mechanisms, including the components of the division machine, how the machine is correctly positioned in the cell, and how division is coordinated with replication and segregation of the chromosome. Insights into these fundamental mechanisms have provided opportunities for the discovery and development of novel antibiotics. This review summarizes how the bacterial cell cycle field has developed over the last 20 or so years, focusing on opportunities emerging from the B. subtilis system.

The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis [PHYSIOLOGY AND BIOCHEMISTRY]

Thu, 05 Nov 2009 04:01:11 PST

The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologs, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of the wild-type strain and the recA mutant strain after exposure to the DNA damaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; recA cultures showed considerably lower rifampicin and streptomycin resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA- and yneA-promoter reporter studies. Subsequently, stress survival studies showed recA mutant cells to be less resistant to heat, H₂O₂, and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the host.

Regulation of Valanimycin Biosynthesis in Streptomyces viridifaciens: Characterization of VlmI as a Streptomyces Antibiotic Regulatory Protein (SARP) [CELL AND MOLECULAR BIOLOGY OF MICROBES]

Garg, R. P, Parry, R. J — Thu, 05 Nov 2009 04:01:10 PST

Streptomyces antibiotic regulatory proteins (SARPs) have been shown to activate transcription by binding to a tandemly arrayed set of heptameric, direct repeats located around the -35 region of their cognate promoters. Experimental evidence showing that VlmI is a regulatory gene in the valanimycin biosynthetic gene cluster of Streptomyces viridifaciens and encodes for a protein belonging to the SARP family is presented here. The organization of the valanimycin biosynthetic gene cluster suggests that the valanimycin biosynthetic genes are located on three potential transcripts, vlmHORBCD, vlmJKL, and vlmA. Disruption of vlmI abolished valanimycin biosynthesis. Western blot analyses showed that VlmR and VlmA are absent from the vlmI mutant and the production of VlmK is severely diminished. These results demonstrate that the expression of these genes from the three potential transcripts is under the positive control of VlmI. The vlmA-vlmH and the vlmI-vlmJ intergenic regions both exhibit a pattern of heptameric, direct repeats. Gel shift assays with VlmI overproduced in E. coli as a C-terminal FLAG-tagged protein clearly demonstrated that VlmI binds to DNA fragments from both regions that contain these heptameric repeats. When a high-copy vlmI expression plasmid was introduced into S. coelicolor M512, which contains mutations in the undecylprodigiosin and actinorhodin activators redD and actII-orf4, undecylprodigiosin production was restored, showing that vlmI can complement a redD mutation. Introduction of the same vlmI expression plasmid into the S. viridifaciens vlmI mutant restored valanimycin production to wild type levels.

Differences in adherence and virulence gene expression between two outbreak strains of enterohemorrhagic Escherichia coli O157:H7 [CELL AND MOLECULAR BIOLOGY OF MICROBES]

Abu-Ali, G. S, Ouellette, L. M, Henderson, S. T, Whittam, T. S, Manning, S. D — Thu, 05 Nov 2009 04:01:10 PST

The Escherichia coli O157:H7 TW14359 strain was implicated in a multi-state outbreak in North America in 2006, which resulted in high rates of severe disease. Similarly, the O157:H7 RIMD0509952 (Sakai) strain caused the largest O157:H7 outbreak to date. Both strains were shown to represent divergent phylogenetic lineages. Here we compared global gene expression patterns before and after epithelial cell exposure as well as the ability to adhere to and invade epithelial cells between the two outbreak strains. Epithelial cell assays demonstrated a 2.5 fold increase in adherence of the TW14359 strain relative to Sakai, while whole-genome microarrays detected significant differential expression of 914 genes, 206 of which had a fold change ≥ 1.5. Interestingly, most locus of enterocyte effacement (LEE) genes were upregulated in TW14359, whereas flagellar and chemotaxis genes were primarily upregulated in Sakai, suggesting discordant expression of these genes between the two strains. The Shiga toxin 2 genes were also upregulated in the TW14359 strain as were several pO157-encoded genes that promote adherence, including type II secretion genes and their effectors stcE and adfO. Quantitative RT-PCR confirmed the expression differences detected in the microarray analysis, and expression levels were lower for a subset of LEE genes before versus after exposure to epithelial cells. In all, this study demonstrated the upregulation of major and ancillary virulence genes in TW14359 and of flagellar and chemotaxis genes in Sakai, under conditions that precede intimate bacterial attachment to epithelial cells. Differences in the level of adherence to epithelial cells were also observed, implying that the two phylogenetically divergent O157:H7 outbreak strains vary in their ability to colonize, or initiate the disease process.

Quorum Sensing Regulated Virulence factors in Pseudomonas aeruginosa are toxic to Lucilia sericata maggots [MICROBIAL PATHOGENICITY]

Thu, 05 Nov 2009 04:01:12 PST

Maggot debridement therapy (MDT) is widely used for debridement of chronic infected wounds, however for wounds harbouring specific bacteria limited effect or failure of the treatment have been described. Here we study the survival of Lucilia sericata maggots encountering Pseudomonas aeruginosa (PAO1) in a simple assay with emphasis on the quorum sensing (QS) regulated virulence. The maggots were challenged with GFP tagged P.aeruginosa WT PAO1 and GFP tagged P. aeruginosa lasR rhlR (RR) QS deficient mutants in different concentrations. Maggots were killed in the presence of WT PAO1 whereas the challenge with the QS mutants showed a survival reduction of (approx 25%) compared to negative controls. Furthermore, bacterial intake by the maggots was reduced in the presence of PAO1, but not by PAO1 (RR) mutant. Maggot excretion/secretions (ES) were assayed for the presence of QS inhibitors and only high doses of ES showed inhibition of QS in P. aeruginosa. Thus P. aeruginosa was shown to be toxic to L. sericata maggots. This coupled to the preferential feeding by the maggots and reduced ingestion of P. aeruginosacould explain the MDT failure in wounds colonised by P. aeruginosa. Wounds heavily colonised with P. aeruginosa should be a counter indication for MDT unless used in combination with a pre-treatment with other topical therapeutics targeting P. aeruginosa.

Listeria monocytogenes does not survive ingestion by Acanthamoeba polyphaga [ENVIRONMENTAL AND EVOLUTIONARY MICROBIOLOGY]

Akya, A., Pointon, A., Thomas, C. — Thu, 05 Nov 2009 04:01:12 PST

Listeria monocytogenes is a ubiquitous bacterium capable of infecting humans including pregnant women and immuno-compromised individuals. Although, the intracellular invasion and pathogenesis of listeriosis in mammalian tissues has been well studied, little is known about the ecology of L. monocytogenes and in particular, the environmental reservoir for this bacterium has not been identified. This study used short-term co-culture at 15, 22 and 37 °C to examine the interaction L. monocytogenes strains with Acanthamoeba polyphaga (ACO12). Survival of L. monocytogenes cells phagocytosed by monolayers of trophozoites was assessed by culture techniques and microscopy. A. polyphaga trophozoites eliminated bacterial cells within few hours post phagocytosis irrespective of the incubation temperature used. Wild-type L. monocytogenes and phenotypic listeriolysin O mutants were unable to either multiply or survive within trophozoites. By contrast, Salmonella enterica serovar Typhimurium C5 cells used as controls were able to survive and multiply within A. polyphaga trophozoites. For A. polyphaga ACO12 the data presented indicated that this amoeba is unlikely to harbour L. monocytogenes, or act as an environmental reservoir for this bacterium.

Genome diversity in Fructobacillus, Leuconostoc and Weissella genera through physical and genetic mapping [GENES AND GENOMES]

Chelo, I. M, Ze-Ze, L., Tenreiro, R. — Thu, 05 Nov 2009 04:01:11 PST

Pulsed-field gel electrophoresis analysis of chromosomal single and double restriction profiles of 17 strains belonging to three "Leuconostocaceae" genera was done, resulting in physical and genetic maps for 3 Fructobacillus, 6 Leuconostoc and 4 Weissella strains. AscI, I-CeuI, NotI and SfiI restriction enzymes were used together with Southern hybridization of selected probes to provide an assessment of genomic organization diversity in different species. Estimated genome sizes varied from 1408 kb to 1547 kb in Fructobacillus, 1644 kb to 2133 kb in Leuconostoc and from 1371 kb to 2197 kb in Weissella. Other genomic characteristics of interest were analysed such as oriC and terC localization and rrn operon organization. This latter seems markedly different in Weissella, both in number and disposition in the chromosome. Comparison of intra- and inter- generic features are discussed in the light of chromosome rearrangements and genomic evolution.

Identification and functional characterization of a gene for the methanol:N,N'-dimethyl-4-nitrosoaniline oxidoreductase from Mycobacterium sp. strain JC1 DSM 3803 [CELL AND MOLECULAR BIOLOGY OF MICROBES]

Park, H., Lee, H., Ro, Y. T., Kim, Y. M. — Thu, 29 Oct 2009 05:01:15 PDT

Mycobacterium sp. strain JC1 is able to grow on methanol as a sole source of carbon and energy using methanol:N,N'-dimethyl-4-nitrosoaniline oxidoreductase (MDO) as a key enzyme for primary methanol oxidation. Purified MDO oxidizes ethanol and formaldehyde as well as methanol. The Mycobacterium sp. strain JC1 gene for MDO (mdo) was cloned, sequenced, and determined to have an open reading frame of 1272 bp. Northern blot and promoter analysis revealed that the mdo transcription was induced in cells grown in the presence of methanol. Northern blot together with RT-PCR also showed that the mdo gene was transcribed as monocistronic mRNA. Primer extension analysis revealed that the transcriptional start site of mdo gene is located 21 bp upstream of the mdo start codon. An mdo-deficient mutant of Mycobacterium sp. strain JC1 did not grow with methanol as a sole source of carbon and energy.

Ensifer, Phyllobacterium and Rhizobium species occupy nodules of Medicago sativa (alfalfa) and Melilotus alba (sweet clover) grown at a Canadian site without a history of cultivation [ENVIRONMENTAL AND EVOLUTIONARY MICROBIOLOGY]

Thu, 29 Oct 2009 05:01:17 PDT

Phage resistant and susceptible bacteria from nodules of alfalfa and sweet clover grown at a site without a known history of cultivation, were identified as diverse genotypes of Ensifer, Rhizobium and Phyllobacterium species based on sequence analysis of ribosomal (16S and 23S rRNA) and protein encoding (atpD and recA) genes, Southern hybridization/RFLP and a range of phenotypic characteristics. Among phage resistant bacteria, one genotype of Rhizobium sp. predominated on alfalfa (frequency c. 68%) but was recovered infrequently (c.1%) from sweet clover. A second genotype was isolated infrequently only from alfalfa. These genotypes fixed nitrogen poorly in association with sweet clover and Phaseolus vulgaris, but were moderately effective with alfalfa. They produced a near-neutral reaction on mineral salts agar containing mannitol, which is atypical of the genus Rhizobium. A single isolate of Ensifer sp. and two of Phyllobacterium sp. were recovered only from sweet clover. All were highly resistant to multiple antibiotics. Phylogenetic analysis indicated that Ensifer sp. strain T173 is closely related to, but separate from the non-symbiotic species, 'Sinorhizobium morelense'. Strain T173 is unique in that it possesses a 175 kb symbiotic plasmid and elicits ineffective nodules on alfalfa, sweet clover, Medicago lupulina and Macroptilium atropurpureum. The Phyllobacterium sp. were non-symbiotic and probably represent bacterial opportunists. Three genotypes of E. meliloti that were symbiotically effective with alfalfa and sweet clover were encountered infrequently. Among phage susceptible isolates, two genotypes of E. medicae were encountered infrequently and were highly effective with alfalfa, sweet clover and Medicago polymorpha. The ecological and practical implications of the findings are discussed.

Alternate Isoleucine Synthesis Pathway in Cyanobacterial Species [PHYSIOLOGY AND BIOCHEMISTRY]

Thu, 29 Oct 2009 05:01:18 PDT

Cyanothece sp. ATCC 51142 is an aerobic N₂-fixing and hydrogen-producing cyanobacterium. Isotopomer analysis of its amino acids reveals an identical labeling profile for leucine and isoleucine when Cyanothece 51142 is grown mixotrophically using [2-¹³C] labeled glycerol as the main carbon source. This indicates that Cyanothece 51142 employs the atypical alternative citramalate pathway for isoleucine synthesis with pyruvate and acetyl-CoA as precursors. Utilization of the citramalate pathway is confirmed by an enzyme assay and LC-MS/MS analysis. Furthermore, the genome sequence of Cyanothece 51142 shows that the gene encoding the key enzyme (threonine ammonia-lyase) in a normal isoleucine pathway is missing. Instead, the cce_0248 gene in Cyanothece 51142 exhibits 53 % identity to the gene encoding citramalate synthase (CimA, GSU1798) from Geobacter sulfurreducens. Reverse transcription PCR also indicates that the cce_0248 gene is expressed and its transcriptional level is lower in the medium with isoleucine than in the isoleucine-free medium. Additionally, a BLAST search for citramalate synthase and threonine ammonia-lyase implies that this alternate isoleucine synthesis pathway may be present in other cyanobacteria, such as Cyanothece and Synechococcus. This suggests that the pathway is more widespread than originally thought, as previous identifications of the citramalate pathway are limited to mostly anaerobic bacteria or archaea. Furthermore, this discovery opens the possibility that such autrotrophic microorganisms may be engineered for robust butanol and propanol production from 2-ketobutyrate, which is an intermediate in the isoleucine biosynthesis pathway.

Epidemiology, variable genetic organisation and regulation of the EDIN-B toxin in Staphylococcus aureus from bacteraemic patients [MICROBIAL PATHOGENICITY]

Franke, G. C., Bockenholt, A., Sugai, M., Rohde, H., Aepfelbacher, M. — Thu, 29 Oct 2009 05:01:15 PDT

EDIN-B (Epidermal cell Differentiation INhibitor-B; also termed C3Stau) is an exotoxin of S. aureus which ADP-ribosylates and inactivates Rho GTP-binding proteins. The EDIN-B gene (edin-B) and the gene for exfoliative toxin D (etd) make up the central part of a recently described pathogenicity island. Here we evaluated the prevalence and genetic organisation of the edin-B/etd pathogenicity island in invasive S. aureus isolates and characterized edin-B transcription and EDIN-B production using artificial constructs transduced in S. aureus strains RN6390 and -Newman. We found that 8 out of 121 (7 %) S. aureus blood culture isolates harbour edin-B which is organised in three novel variants of the original edin-B/etd pathogenicity island. In the serum of patients infected with edin-B positive S. aureus significant titres of anti-EDIN-B antibodies could be detected. Regulation of edin-B transcription depended on the sarA- but not on the agr regulatory system. Furthermore, retrieval of EDIN-B protein secreted by S. aureus RN6390 required the presence of 2-macrogobulin to inhibit the activity of extracellular proteases. These data suggest that the EDIN-B toxin is produced during human infection, is part of a highly variable pathogenicity island and can be controlled by the sarA gene regulon and secreted bacterial proteases.

The inositol regulon controls viability in Candida glabrata [CELL AND MOLECULAR BIOLOGY OF MICROBES]

Bethea, E. K, Carver, B. J, Montedonico, A. E, Reynolds, T. B — Thu, 29 Oct 2009 05:01:16 PDT

Inositol is essential in eukaryotes, and must be imported or synthesized. Inositol biosynthesis in Saccharomyces cerevisiae is controlled by three nonessential genes that make up the inositol regulon: ScINO2 and ScINO4, which together encode a heterodimeric transcriptional activator, and ScOPI1, which encodes a transcriptional repressor. ScOpi1p inhibits the ScIno2-ScIno4p activator in response to extracellular inositol levels. An important gene controlled by the inositol regulon is ScINO1, which encodes inositol-3-phosphate synthase, a key enzyme in inositol biosynthesis. In the pathogenic yeast Candida albicans, homologs of the S. cerevisiae inositol regulon genes are "transcriptionally rewired". Instead of regulating the CaINO1 gene, CaINO2 and CaINO4 regulate ribosomal genes. Another Candida species that is a prevalent cause of infections is Candida glabrata, however, C. glabrata is phylogenetically more closely related to S. cerevisiae than C. albicans. Experiments were designed to determine if C. glabrata homologs of the inositol regulon genes function similarly to S. cerevisiae or are transcriptionally rewired. CgINO2, CgINO4, and CgOPI1 regulate CgINO1 in a manner similar to that observed in S. cerevisiae. However, unlike in S. cerevisiae, CgOPI1 is essential. Genetic data indicate that CgOPI1 is a repressor that affects viability by regulating activation of a target of the inositol regulon.

Fungal Physiology - A Future Perspective [REVIEW]

Wilson, R. A, Talbot, N. J — Thu, 22 Oct 2009 04:30:57 PDT

The study of fungal physiology is set to change dramatically in the next few years as highly scalable technologies are deployed allowing accurate measurement and identification of metabolites, proteins and transcripts within cells. The advent of next generation DNA sequencing technologies will also provide genome sequence information from large numbers of industrially relevant and pathogenic fungal species, and allow comparative genome analysis between strains and populations of fungi. When coupled with advances in gene functional analysis, protein-protein interaction studies, live cell imaging and mathematical modeling, this promises a step-change in our understanding of how fungal cells operate as integrated dynamic living systems.

Fungal physiology and the origins of molecular biology [REVIEW]

Brambl, R. — Thu, 22 Oct 2009 04:30:58 PDT

Molecular biology has several distinct origins, but especially important are those contributed by fungal and yeast physiology, biochemistry, and genetics. From the first gene action studies that became the basis of our understanding of the relationship between genes and proteins, through chromosome structure, mitochondrial genetics and membrane biogenesis, gene silencing, and circadian clocks, studies with these organisms have yielded basic insight into these processes applicable to all eukaryotes. Examples are cited of pioneering studies with fungi that have stimulated new research in clinical medicine and agriculture; these studies include sexual interactions, cell stress responses, the cytoskeleton, and pathogenesis. Studies with the yeasts and fungi have been effective in applying the techniques and insights gained from other types of experimental systems to research in fungal cell signaling, cell development, and hyphal morphogenesis.

Study of the distribution of autotrophic CO2 fixation cycles in Crenarchaeota [PHYSIOLOGY AND BIOCHEMISTRY]

Berg, I. A, Ramos-Vera, W. H., Petri, A., Huber, H., Fuchs, G. — Thu, 22 Oct 2009 04:31:00 PDT

Two new autotrophic carbon fixation cycles were recently described in Crenarchaeota. The 3-hydroxypropionate/4-hydroxybutyrate cycle using acetyl-coenzyme A (CoA)/propionyl-CoA carboxylase as the carboxylating enzyme was shown for (micro)aerobic members of the Sulfolobales. The dicarboxylate/4-hydroxybutyrate cycle using oxygen-sensitive pyruvate synthase and phosphoenolpyruvate carboxylase as carboxylating enzymes was found in members of the anaerobic Desulfurococcales and Thermoproteales. However, Sulfolobales harbor anaerobic and Desulfurococcales aerobic autotrophic representatives, raising the question which of the two cycles they use. We studied the mechanisms of autotrophic CO2 fixation in the strictly anaerobic Stygiolobus azoricus (Sulfolobales) and in the facultatively aerobic Pyrolobus fumarii (Desulfurococcales). The activities of all enzymes of the 3-hydroxypropionate/4-hydroxybutyrate cycle were shown in the anaerobic S. azoricus. In contrast, the aerobic or denitrifying P. fumarii possesses all enzyme activities of the dicarboxylate/4-hydroxybutyrate cycle. We conclude that autotrophic Crenarchaeota use one of the two cycles, and their distribution correlates with the 16S rRNA-based phylogeny of this group, rather than with the aerobic or anaerobic life style.

Sugar source modulates exopolysaccharide biosynthesis in Bifidobacterium longum subsp. longum CRC 002 [CELL AND MOLECULAR BIOLOGY OF MICROBES]

Audy, J., Labrie, S., Roy, D., LaPointe, G. — Thu, 22 Oct 2009 04:31:03 PDT

The effect of four sugars (glucose, galactose, lactose, and fructose) on EPS production by B. longum subsp. longum CRC 002 was evaluated. More EPS was produced when CRC 002 was grown on lactose in the absence of pH control with a production of 1080 ± 120 mg EPS l-1 (p < 0.01) after 24 h of incubation. For fructose, galactose and glucose, EPS production was similar at 512 ± 63 mg EPS l-1, 564 ± 165 mg EPS l-1 and 612 ± 93 mg EPS l-1, respectively. The proposed repeating unit composition of the EPS is 2 galactose to 3 glucose. The effect of sugar and fermentation time on expression of genes involved in sugar nucleotide production (galK, galE1, galE2, galT1, galT2, galU, rmlA, rmlB1 and rmlCD) and the priming glycosyltransferase (wblE) was quantified using real time reverse transcription PCR (Q-RT-PCR). A significantly higher transcription level of wblE (9.29-fold) and the genes involved in the Leloir pathway (galK: 4.10-fold, galT1: 2.78-fold and galE2: 4.95-fold) during exponential growth are associated with enhanced EPS production on lactose compared to glucose. However, galU expression, linking glucose metabolism with the Leloir pathway, is not correlated with EPS production on different sugars. Genes coding for dTDP-rhamnose biosynthesis were also differentially expressed depending on sugar source and growth phase, although rhamnose was not present in the composition of the EPS. This precursor may be used in cell wall polysaccharide biosynthesis. These results contribute to understanding changes in gene expression when different sugar substrates are catabolized by B. longum subsp. longum CRC 002.

Transcriptional and functional characterization of the gene coding for acyl carrier protein from Bacillus subtilis [CELL AND MOLECULAR BIOLOGY OF MICROBES]

Martinez, M. A, de Mendoza, D., Schujman, G. E — Thu, 22 Oct 2009 04:31:03 PDT

Acyl carrier protein (ACP) is a universal and highly conserved carrier of acyl intermediates during fatty acid biosynthesis. The molecular mechanism of regulation of the acpP structural gene as well as the function of its gene product is poorly characterized in Bacillus subtilis and other Gram-positive organisms. Here we report that transcription of acpP takes place from two different promoters, PfapR and PacpP. Expression of acpP from PfapR is coordinated with a cluster of genes involved in lipid synthesis (the fapR operon) constituted by fapR-plsX-fabD-fabG-acpP. PacpP is located immediately upstream of the acpP coding sequence and is necessary and sufficient for normal fatty acid synthesis. We also report that acpP is essential for growth and differentiation and that ACP localizes in the mother cell compartment of the sporangium during spore formation. These results provide the first detailed characterization of the expression of ACP in a Gram-positive bacterium and highlight the importance of this protein in B. subtilis physiology.

Genetic determinants of Pseudomonas aeruginosa biofilm establishment [MICROBIAL PATHOGENICITY]

Musken, M., DiFiore, s., Dotsch, A., Fischer, R., Haussler, S. — Thu, 22 Oct 2009 04:30:57 PDT

The establishment of bacterial biofilms on surfaces is a complex process that requires various factors for each consecutive developmental step. Here we report the screen of the comprehensive Harvard Pseudomonas aeruginosa PA14 mutant library for mutants exhibiting an altered biofilm phenotype. We analyzed the capability of all mutants to form biofilms at the bottom of a 96-well plate by the use of an automated confocal laser scanning microscope and uncovered 394 and 285 genetic determinants of reduced and enhanced biofilm production, respectively. Overall, 67% of the identified mutants were affected within genes encoding for hypothetical proteins indicating that novel developmental pathways are likely to be dissected in the future. Nevertheless, a common theme that emerged from the analysis of the genes with a predicted function is that the establishment of a biofilm requires regulatory components that are involved in survival under microaerophilic growth conditions, arginine metabolism, alkyl-quinolone signaling, pH homeostasis and the DNA repair system.

Regulation of the dauBAR Operon and Characterization of D-Amino Acid Dehydrogenase DauA in Arginine and Lysine Catabolism of Pseudomonas aeruginosa PAO1 [PHYSIOLOGY AND BIOCHEMISTRY]

Li, C., Yao, X., Lu, C.-D. — Thu, 22 Oct 2009 04:31:00 PDT

A unique D-to-L racemization of arginine by coupled arginine dehydrogenases DauA and DauB encoded by the dauBAR operon was recently reported as pre-requisite for D-arginine utilization as sole source of carbon and nitrogen through L-arginine catabolic pathways in P. aeruginosa. Here in this study, enzymatic properties of the catabolic FAD-dependent D-amino acid dehydrogenase DauA and the physiological functions of the dauBAR operon were further characterized with other D-amino acids. These results establish DauA as D-amino acid dehydrogenase of broad substrate specificity, with D-Arg and D-Lys as the two most effective substrates based on the kinetic parameters. In addition, expression of dauBAR is specifically induced by exogenous D-Arg and D-Lys, and mutations in dauBAR operon affect utilization of these two amino acids only. The function of DauR as repressor in control of the dauBAR operon was demonstrated by dauB promoter activity measurements in vivo and mobility shift assays with purified His-tagged protein in vitro. The potential effect of 2-ketoarginine (2-KA) derived from D-Arg deamination by DauA as signal molecule of dauBAR induction was first revealed from mutation analysis and further supported by its in vitro effect on alleviation of DauR-DNA interactions. Through sequence analysis, putative DauR operators were identified and confirmed by mutation analysis. Induction of the dauBAR operon to the maximal level was found to require the L-arginine responsive regulator ArgR, as supported by the loss of inductive effect by L-arg on dauBAR expression in the argR mutant and binding of purified ArgR to the dauB regulatory region in vitro. In summary, this study established that optimal induction of the dauBAR operon requires relief of DauR repression by 2-KA and activation of ArgR by L-Arg as a result of D-Arg racemization by the encoded DauA and DauB.

New insights into the regulatory networks of paralogous genes [REVIEW]

Martinez-Nunez, M. A., Perez-Rueda, E., Gutierrez-Rios, R. M., Merino, E. — Thu, 22 Oct 2009 04:30:59 PDT

Extensive genomic studies on gene duplication in model organisms, such as Escherichia coli and Saccharomyces cerevisiae have recently been undertaken. In these models, it is commonly considered that a duplication event may include a Transcription Factor (TF), a Target Gene (TG), or both. Following a gene duplication episode, varying scenarios have been postulated to describe the evolution of the regulatory network. However in most of these, the TFs have emerged as the most important and in some cases the only factor shaping the regulatory network as the organism responds to a natural selection process, in order to fulfill its metabolic needs. Recent findings, concerning the regulatory role played by elements, other than TFs, have indicated the need to reassess these early models. Thus, we performed an exhaustive review of paralogous gene regulation in E. coli and Bacillus subtilis based on published information, available at the NCBI PubMed and from well established regulatory databases. Our survey reinforces the notion that despite TFs being the most prominent components shaping the regulatory networks; other elements are also important. These include small RNAs, riboswitches, RNA-binding proteins, sigma factors, protein-protein interactions and DNA supercoiling, which modulate the expression of genes involved in particular metabolic processes or induce a more complex response in terms of the regulatory networks of paralogous genes in an integrated interplay with TFs.

Hydrophobic carboxy-terminal residues dramatically reduce protein levels in the haloarchaeon Haloferax volcanii [PHYSIOLOGY AND BIOCHEMISTRY]

Reuter, C. J., Uthandi, S., Puentes, J. A., Maupin-Furlow, J. A. — Thu, 22 Oct 2009 04:30:59 PDT

Proteolysis is important not only to cell physiology but also to the successful development of biocatalysts. While a wide-variety of signals are known to trigger protein degradation in bacteria and eukaryotes, these mechanisms are poorly understood in archaea known for their ability to withstand harsh conditions. Here we present a systematic study in which single C-terminal amino acid residues were added to a reporter protein and shown to influence its levels in an archaeal cell. All twenty amino acid residues were examined for their impact on protein levels, using the reporter protein soluble modified red-shifted green fluorescent protein (smRS-GFP) expressed in the haloarchaeon Haloferax volcanii as a model system. Our results demonstrate that addition of hydrophobic residues including Leu, Cys, Met, Phe, Ala, Tyr, Ile and Val had the most pronounced reduction in smRS-GFP levels compared to the addition of either neutral or charged hydrophilic residues. In contrast to the altered protein levels, the C-terminal alterations had no influence on smRS-GFP-specific transcript levels, thus revealing the effect is post-transcriptional.

Characterization of a virulent and cell-wall-located deoxyribonuclease of Streptococcus pyogenes [MICROBIAL PATHOGENICITY]

Hasegawa, T., Minami, M., Okamoto, A., Tatsuno, I., Isaka, M., Ohta, M. — Thu, 22 Oct 2009 04:30:59 PDT

We investigated culture supernatant proteins from the M1 serotype Streptococcus pyogenes by 2-dimensional gel electrophoresis and peptide mass mapping analysis, and we characterized the single protein spots. Among them, we analyzed the Spy0747 protein. This protein is homologous to the SsnA protein, which is a cell-wall-located DNase expressed in S. suis serotype 2. We designated the Spy0747 protein as SpnA. SpnA protein was also detected in the insoluble fraction of whole cell lysates using shotgun proteomic analysis and this result suggests that SpnA is also located in the cell wall. SpnA was expressed as a glutathione S-transferase-fusion protein in Escherichia coli. We confirmed that the recombinant protein had deoxyribonuclease activity that was dependent on Ca2+ and Mg2+ like SsnA. Blood bactericidal assays and mouse infection model experiments showed that the spnA knock-out strain was less virulent compared to the parental strain, thus suggesting that SpnA could play an important role in virulence. Using PCR, we found that the spnA gene was present in all clinical S. pyogenes strains examined in this study. Our results and the previous report that Spy0747 was identified as a surface-associated protein suggest that SpnA, an important cell-wall-located DNase, is involved in virulence that is generally produced in S. pyogenes.

The hrcA and hspR regulons of Campylobacter jejuni [CELL AND MOLECULAR BIOLOGY OF MICROBES]

Holmes, C. W, Penn, C. W, Lund, P. A — Thu, 22 Oct 2009 04:30:58 PDT

The human pathogen Campylobacter jejuni has a classic heat shock response, showing induction of chaperones and proteases plus several unidentified proteins in response to small increase in growth temperature. The genome contains two homologues to known heat shock response regulators, HrcA and HspR. Previous work has shown that HspR controls several heat shock genes, but the hrcA regulon has not been defined. We have constructed single and double deletions of C. jejuni hrcA and hspR and analysed gene expression using microarrays. Only a small number of genes are controlled by these two regulators, and the two regulons overlap. Strains mutated in hspR, but not those mutated in hrcA, showed enhanced thermotolerance. Some genes previously identified as being down-regulated in a strain lacking hspR showed no change in expression in our experiments.

Purification and characterization of a clostripain-like protease from a recombinant Clostridium perfringens culture [MICROBIAL PATHOGENICITY]

Thu, 22 Oct 2009 04:30:58 PDT

Clostridium perfringens produces a homologue of clostripain (Clo), the arginine-specific endopeptidase of Clostridium histolyticum. To determine the biochemical and biological properties of the C. perfringens homologue (Clp), it was purified from the culture supernatant of a recombinant C. perfringens strain by cation exchange chromatography and ultrafiltration. Analysis by SDS-PAGE, N-terminal amino acid sequencing and TOF mass spectrometry revealed that Clp consists of two polypeptides comprising heavy (38-kDa) and light (16-kDa or 15-kDa) chains, and that the two light chains differ in the N-terminal cleavage site. Such a difference in the light chain did not affect the enzymatic activity toward N-benzoyl-L-arginine p-nitroanilide (Bz-L-arginine pNA), as demonstrated on assaying culture supernatants differing in the relative ratio of the two light chains. Although the purified Clp degraded Bz-DL-arginine pNA more preferentially than Bz-DL-lysine pNA, it degraded the latter more efficiently than Clo. Clp showed 2.3-fold higher caseinolytic activity than Clo, as expected from the difference in the substrate specificity. Clp caused an increase in vascular permeability when injected intradermally in mice, implying a possible role of Clp in the pathogenesis of clostridial myonecrosis.

Molecular Typing of Mycobacterium intracellulare using Multilocus Variable-Number of Tandem-Repeat Analysis: Identification of Loci and Analysis of Clinical Isolates [ENVIRONMENTAL AND EVOLUTIONARY MICROBIOLOGY]

Thu, 22 Oct 2009 04:31:02 PDT

In addition to its known status as a disseminated disease in HIV-positive patients, Mycobacterium avium complex (MAC) is increasingly recognized as a causative pathogen of respiratory disease in HIV-negative patients. MAC is divided into Mycobacterium avium, and the less-epidemiologically studied Mycobacterium intracellulare. Genetic typing for M. intracellulare using variable number of tandem repeats (VNTR) has not yet been developed. The aim of this study was to identify VNTR loci in the genome of Mycobacterium intracellulare and apply them as an epidemiological tool to clinical isolates. Here, we identified 25 VNTR loci on the Mycobacterium intracellulare genome, of which 16 showed variations among clinical isolates in the number of tandem repeat motifs. Among the 74 Mycobacterium intracellulare isolates, 50 genotypes were distinguished using the 16 VNTR loci, resulting in a Hunter Gaston's Discriminatory Index of 0.988. Moreover, all 16 VNTR loci were stable in different sets of isolates recovered within time intervals ranging from 2 to 1551 days from 14 separate patients. These results indicate that for use as epidemiological markers of Mycobacterium intracellulare, the loci in this VNTR assay are highly discriminating and stable over time.

Processing, Assembly, and Localization of a Bacillus anthracis Spore Protein [MICROBIAL PATHOGENICITY]

Thu, 15 Oct 2009 07:01:15 PDT

All Bacillus spores are encased in macromolecular shells. One of these is a proteinacious shell called the coat that, in Bacillus subtilis, provides critical protective functions. The Bacillus anthracis spore is the infectious particle for the disease anthrax. Therefore, the coat is of particular interest because it may provide essential protective functions required for the appearance of anthrax. Here, we analyze a protein component of the spore outer layers that was previously designated as BxpA. Our data indicate that a significant amount of BxpA is located below the spore coat and associated with the cortex. By SDS-PAGE, BxpA migrates as a 9-kD species when extracted from Sterne strains spores, and as 11- and 14-kD species from Ames strain spores, even though it has predicted masses of 27-kD and 29-kD, respectively, in these two strains. We investigated the possibility that BxpA is subject to posttranslational processing as previously suggested. In B. subtilis, a subset of coat proteins is proteolyzed or crosslinked by the spore proteins YabG or Tgl, respectively. To investigate the possibility that similar processing occurs in B. anthracis, we generated mutations in the yabG or tgl genes in the Sterne and Ames strains and analyzed the consequences for BxpA assembly by SDS-PAGE. We found that in a tgl mutant of B. anthracis, the apparent mass of BxpA increased. This is consistent with the possibility that Tgl directs the crosslinking of BxpA into a form that normally does not enter the gel. Unexpectedly, the apparent mass of BxpA also increased in a yabG mutant, suggesting a relatively complex role for proteolysis in spore protein maturation in B. anthracis. These data reveal a previously unobserved event in spore protein maturation in B. anthracis. We speculate that proteolysis and crosslinking are ubiquitous spore assembly mechanisms throughout the genus Bacillus.

Carbonic anhydrases in fungi [MINI-REVIEW]

Elleuche, S., Poggeler, S. — Thu, 15 Oct 2009 07:01:14 PDT

Carbonic anhydrases (CAs) are metalloenzymes that catalyze the interconversion of carbon dioxide and bicarbonate with high efficiency. This reaction is fundamental to biological processes such as respiration, photosynthesis, pH homeostasis, CO₂ transport and electrolyte secretion. CAs are distributed among all three domains of life, and are currently divided into five evolutionarily unrelated classes (alpha, beta, gamma, delta and zeta). Fungal CAs have only recently been identified and characterized in detail. While Saccharomyces cerevisiae and Candida albicans each have only one beta-CA, multiple copies of beta-CA- and alpha-CA-encoding genes are found in other fungi. Recent work demonstrates that CAs play an important role in the CO₂-sensing system of fungal pathogens and in the regulation of sexual development. This review will focus on CA functions in S. cerevisiae, the fungal pathogens C. albicans and Cryptococcus neoformans, and the filamentous ascomycete Sordaria macrospora.

Myo-inositol transport by Salmonella enterica serovar Typhimurium [GENES AND GENOMES]

Kroger, C., Stolz, J., Fuchs, T. M. — Thu, 15 Oct 2009 07:01:09 PDT

In Salmonella enterica serovar Typhimurium, the genomic island GEI4417/4436 has recently been identified to be responsible for myo-inositol (MI) utilization. Here, two of the four island-encoded permeases are reported as the MI transporters of this pathogen. In-frame deletion of iolT1 (STM4418) led to severe, inactivation of iolT2 (STM4419) to slight growth deficiencies in the presence of MI. These phenotypes could be complemented by providing the putative transporter genes in trans. Bioluminescence-based reporter assays demonstrated a strong induction of their promoters PiolT1 and of PiolT2 in the presence of MI but not glucose. Deletion of iolR encoding the negative regulator of most genes involved in MI degradation resulted in up-regulation of PiolT1 and of PiolT2, indicating that the expression of IolT1 and IolT2 is repressed by IolR. This finding was supported by bandshift assays using purified IolR. Both transporters are localized in the membrane when expressed in Escherichia coli. Heterologously expressed IolT1 had its optimal activity at pH 5.5. Together with the strongly reduced MI uptake in the presence of protonophores, this indicates that IolT1 operates as a proton symporter. Using myo-[1,2-3H(N)]inositol, a saturable uptake activity of IolT1 with a Km value between 0.49 mM and 0.79 mM was determined in DH5 expressing IolT1, in S. enterica serovar Typhimurium strain 14028, and in mutant 14028 iolT2. Phylogenetic analysis of IolT1 identified putative MI transporters in Gram-negative bacteria also able to utilize MI.

VEJ{varphi}, a novel filamentous phage of Vibrio cholerae able of transducing the cholera toxin genes [ENVIRONMENTAL AND EVOLUTIONARY MICROBIOLOGY]

Campos, J., Martinez, E., Izquierdo, Y., Fando, R. A. — Thu, 15 Oct 2009 07:01:11 PDT

A novel filamentous bacteriophage, designated VEJ, was isolated from the strain MO45 of Vibrio cholerae of the O139 serogroup. A molecular characterization of the phage was carried out, which included the sequencing of its whole genome, the study of the genomic structure, the identification of the phage receptor, as well as the determination of the function of some genes, such as those encoding the major capsid protein and the single-stranded DNA binding proein. The genome nucleotide sequence of VEJ, which consists of 6842 bp, revealed that it is organized in modules of functionally related genes in an array which is characteristic of the genus inovirus (filamentous phages). VEJ is closely related with other previously described filamentous phages of V. cholerae, including VGJ, VSK and fs1. Like these phages, VEJ uses as a cellular receptor the type IV pilus called mannose sensitive hemagglutinin (MSHA). It was also demonstrated that VEJ, like the phage VGJ, is able to transmit the genome of the phage CTX horizontally among bacterial populations of V. cholerae expressing the MSHA receptor fimbria and therefore the genes encoding the cholera toxin (CT). This suggests that the variety of phages implicated in the horizontal transmission of the CT genes could be more diverse than formerly thought.

An observational study of the microbiome of the maternal pouch and saliva of the tammar wallaby, Macropus eugenii and of the gastrointestinal tract of the pouch young [ENVIRONMENTAL AND EVOLUTIONARY MICROBIOLOGY]

Chhour, K.-L., Hinds, L. A., Jacques, N. A., Deane, E. M. — Thu, 15 Oct 2009 07:01:10 PDT

Marsupial mammals, born in an extremely atricial state with no functional immune system, offer a unique opportunity to investigate both the developing microbiome and its relationship to that of the mother and the potential influence of this microbiome upon the development of the immune system. In this study we used a well established marsupial model animal, Macropus eugenii, the tammar wallaby, to document the microbiome of three related sites: the maternal pouch and saliva and the gastrointestinal tract (GIT) of the young animal. We used molecular based methods targeting the 16S rDNA gene to determine the bacterial diversity at these study sites. In the maternal pouch, 41 unique phylotypes, predominantly belonging to the phylum Actinobacteria were detected, while in the saliva 48 unique phylotypes were found that predominantly belonged to the phylum Proteobacteria. The GIT of the pouch young had a complex microbiome of 53 unique phylotypes even though the pouch young were still permanently attached to the teat and had only been exposed to the external environment for a few minutes immediately after birth while making their way from the birth canal to the maternal pouch. Of these 53 phylotypes only 9 were detected at maternal sites. Overall, the majority of bacteria isolated were novel species (<97 % identity to known 16S rDNA sequences) and each study site (i.e. maternal pouch and saliva, and the GIT of the pouch young) possessed its own unique microbiome

A Previously Uncharacterized Gene, yjfO (bsmA) Influences Escherichia coli Biofilm Formation and Stress Response [CELL AND MOLECULAR BIOLOGY OF MICROBES]

Weber, M. M, French, C. L, Barnes, M. B, Siegele, D. A, McLean, R. J. C. — Thu, 15 Oct 2009 07:01:13 PDT

Bacteria growing as surface-adherent biofilms are better able to withstand chemical and physical stresses than their unattached, planktonic counterparts. Using transcriptional profiling and quantitative PCR, we observed a previously uncharacterized gene, yjfO, to be upregulated during Escherichia coli MG1655 biofilm growth in a chemostat on serine-limited defined medium. A yjfO mutant, developed through targeted insertion mutagenesis, and a yjfO-complemented strain, were obtained for further characterization. While bacterial surface colonization levels (CFU/cm2) were similar in all three strains, the mutant strain exhibited reduced microcolony formation when observed in flow cells, and greatly enhanced flagellar motility on soft (0.3%) agar. Complementation of yjfO restored microcolony formation and flagellar motility to wild type levels. Cell surface hydrophobicity and twitching motility were unaffected by the presence or absence of yjfO. In contrast to the parent strain, biofilms from the mutant strain were less able to resist acid and peroxide stresses. yjfO had no significant effect on E. coli biofilm susceptibility to alkali or heat stress. Planktonic cultures from all three strains showed similar responses to these stresses. Regardless of the presence of yjfO, planktonic E. coli withstood alkali stress better than biofilm populations. Complementation of yjfO restored viability following exposure to peroxide stress, but did not restore acid resistance. Based on its influence on biofilm maturation, stress response, and effects on motility, we propose renaming the uncharacterized gene, yjfO, as bsmA (biofilm stress and motility).

The resistance-nodulation-division efflux pump EmhABC influences the production of 2,4-diacetylphloroglucinol in Pseudomonas fluorescens 2P24 [CELL AND MOLECULAR BIOLOGY OF MICROBES]

Tian, T., Wu, X.-G., Duan, H.-M., Zhang, L.-Q. — Thu, 15 Oct 2009 07:01:08 PDT

The polyketide metabolite 2,4-diacetylphloroglucinol (2,4-DAPG) plays a major role in the biological control of soil-borne plant diseases by Pseudomonas fluorescens 2P24. Two mutants (PM810 and PM820) with increased extracellular production of 2,4-DAPG were isolated using transposon mutagenesis. The disrupted genes in these 2 mutants shared >80% identity with the genes of the EmhR-EmhABC resistance-nodulation-division (RND) efflux system of P. fluorescens cLP6a. The deletion of emhA (PM802), emhB (PM803) or emhC (PM804) genes in strain 2P24 increased the accumulation of 2,4-DAPG, whereas the deletion of emhR (PM801) gene decreased the biosynthesis of 2,4-DAPG. The promoter assay confirmed the elevated transcription of emhABC in the EmhR disrupted strain (PM801) and an indirect negative regulation of the EmhABC pump on the transcription of the 2,4-DAPG biosynthetic locus. Induction by exogenous 2,4-DAPG led to remarkable differences in transcription of chromosome-borne phlA::lacZ fusion in PM901 and PM811 (emhA-) strains. Additionally, the EmhABC system in strain 2P24 was involved in the resistance to a group of toxic compounds, including ampicillin, chloramphenicol, tetracycline, ethidium bromide and crystal violet. In conclusion, our results suggested that the EmhABC system is an important element influencing the production of antibiotic 2,4-DAPG and for enhancing resistance to toxic compounds in P. fluorescens 2P24.

Genetic and biochemical analysis of a class C nonspecific acid phosphatase (NSAP) of Clostridium perfringens [CELL AND MOLECULAR BIOLOGY OF MICROBES]

Wang, R., Ohtani, K., Wang, Y., Yuan, Y., Hassan, S., Shimizu, T. — Thu, 15 Oct 2009 07:01:07 PDT

Clostridium perfringens, a Gram-positive anaerobe, is a human pathogen that causes gas gangrene in muscle tissues. Its ability to grow and survive in the host is believed to be responsible for the production of numerous enzymes that enable the organism to obtain essential nutritional sources from the host. In this study, CPE0201, a putative acid phosphatase gene deduced by genome analysis, was shown to encode the nonspecific acid phosphatase in C. perfringens. Multiple alignments of the amino acid sequence showed that CPE0201 shares two signature motifs that belong to a class C acid phosphatase family. Expression of CPE0201 was shown to be positively regulated by the global VirR/VirS-VR-RNA regulatory cascade at the transcriptional level. To determine CPE0201's acid phosphatase activity, cloning, expression, purification and several biochemical characterizations of CPE0201 were carried out to reveal related properties. The optimum pH for CPE0201 activity was 4.8, and its Vmax and Km were 3.08 nmol ml^-1 min^-1 and 2.84 mM, respectively, when p-nitrophenyl phosphate (PNPP) was used as a substrate. The CPE0201 mutant did not grow in a minimum medium containing PNPP, while it showed normal growth when Na2HPO4 was added to the medium. We presume that the enzyme is possibly associated with the surface of the cell to acquire inorganic phosphates derived from organic phosphomonoesters in acidic conditions, which would play an important role in the survival and growth of C. perfringens in the host tissue.

Attraction of Brachyspira pilosicoli to mucin [MICROBIAL PATHOGENICITY]

Naresh, R., Hampson, D. J. — Thu, 15 Oct 2009 07:01:12 PDT

The anaerobic intestinal spirochaete Brachyspira pilosicoli colonises the large intestine of various species, including human beings. In the colon the spirochaete can penetrate the overlying mucus layer, attach by one cell end to the underlying enterocytes, and initiate localised colitis and diarrhoea. The aim of this study was to investigate whether, as part of the colonisation process, B. pilosicoli is attracted to mucin. Fifteen B. pilosicoli strains isolated from humans, pigs, chickens and dogs, and a control strain of Brachyspira hyodysenteriae, were analysed for their ability to enter solutions of hog gastric mucin in an in vitro capillary tube assay. No attraction was detected with 1 % mucin, but some strains started to enter a 2 % solution, and attraction then increased with increasing concentrations to peak at around 6 - 8 % mucin. A similar increase was seen with B. hyodysenteriae, although this activity peaked at 6 % mucin and then declined, suggesting that the two species have different affinities for mucin. These mucin concentrations were much higher than those used in previous experimental studies with Brachyspira species. The viscosities of the 6 - 8 % mucin solutions were around 7 - 12 mPa.s, which were similar to the measured viscosities of the mucus layer overlying the epithelium in the caecum and colon of experimental pigs. The strains varied in their motility, as assessed by their ability to enter tubes containing chemotaxis buffer, but there was no significant relationship between this motility and the extent of their ability to enter the mucin solutions. Different strains also had different propensities to enter the mucin solutions, but there were no consistent differences according to the host species of origin. B. pilosicoli strain 95/1000 was attracted towards a solution of D-serine, suggesting that chemotaxis was involved in the attraction to mucin; however, 95/1000 also was attracted to viscous solutions of polyvinylpyrillodone (PVP), in a manner mirroring the response to mucin, and hence suggesting the involvement of viscotaxis in the attraction to mucin. B. hyodysenteriae B204 showed a similar viscotaxis to PVP. Further studies are required to determine whether the in vitro interactions of a given strain with mucin is a useful indicator of its in vivo colonisation ability, and hence could be used as a potential marker for virulence.

The Bam (Omp85) complex is involved in secretion of the autotransporter haemoglobin protease [MICROBIAL PATHOGENICITY]

Thu, 08 Oct 2009 04:01:18 PDT

Autotransporters are large virulence factors secreted by Gram-negative bacteria. They are synthesized with a C-terminal domain that forms a β-barrel pore in the outer membrane implicated in translocation of the upstream 'passenger' domain across the outer membrane. However, recent structural data suggest that the diameter of the β-barrel pore is not sufficient to allow the passage of partly folded structures observed for several autotransporters. Here, we have used a stalled translocation intermediate of the autotransporter Hbp to identify components involved in insertion and translocation of the protein across the outer membrane. At this intermediate stage the β-domain was not inserted and folded as an integral β-barrel in the outer membrane whereas part of the passenger was surface exposed. The intermediate was copurified with the periplasmic chaperone SurA and subunits of the Bam (Omp85) complex that catalyze the insertion and assembly of outer membrane proteins. The data suggest a critical role for this general machinery in the translocation of autotransporters across the outer membrane.

Defects in flagellin glycosylation affect the virulence of Pseudomonas syringae pv. tabaci 6605 [MICROBIAL PATHOGENICITY]

Thu, 08 Oct 2009 04:01:19 PDT

Flagellar motility and its glycosylation are indispensable for the virulence of Pseudomonas syringae pv. tabaci 6605. Six serine residues of flagellin protein at positions 143, 164, 176, 183, 193, and 201 are glycosylated, and the glycan structure at 201 was determined to consist of a trisaccharide of two L-rhamnosyl residues and a modified 4-amino-4,6-dideoxyglucosyl (viosamine) residue. To investigate the glycan structures attached to the other serine residues and to identify the important glycans for virulence, Ser/Ala-substituted mutants were generated. Six mutant strains that each retained a single glycosylated serine residue were generated by replacing five of the six serine residues with alanine residues. Matrix-assisted laser desorption/ionization time of flight (MALDI-TOF) mass analysis of flagellin proteins revealed that the major composition of each glycan was a trisaccharide basically similar to that at position 201, but with heterogeneity in glycoform distribution. Swarming motility and amounts of acyl homoserine lactones (AHLs) as quorum-sensing signal molecules were significantly reduced, especially in the S143-5S/A and S201-5S/A mutants, whereas tolerance to antibiotics was increased in these two mutants. All the mutants showed lower ability to cause disease on host tobacco plants. These results supported our previous finding that the glycosylation of the sites located on the most external surface, such as S176 and S183, are required for virulence in P. syringae pv. tabaci 6605. Furthermore, it is speculated that flagellum-dependent motility might be correlated with quorum sensing and antibiotic resistance.

The effect of sub-inhibitory concentrations of benzalkonium chloride on the competitiveness of Pseudomonas aeruginosa grown in continuous culture [PHYSIOLOGY AND BIOCHEMISTRY]

McCay, P. H., Ocampo-Sosa, A. A., Fleming, G. T. A. — Thu, 08 Oct 2009 04:01:19 PDT

This study investigates the link between adaptation to biocides and antibiotics in Pseudomonas aeruginosa. An enrichment continuous culture of P. aeruginosa NCIMB 10421 (MIC: 25 mg BKC l-1) was operated (D = 0.04 h-1, 792 h) with added benzalkonium chloride (BKC). A derivative, PA-29, (696 h), demonstrated a >12-fold decrease in sensitivity to the biocide (MIC: > 350 mg BKC l-1). The variant demonstrated a 256-fold increase in resistance to ciprofloxacin, with a mutation in the gyrA gene (Thr-83->Ile). Similarly, culturing of the original strain in a continuous culture system with ciprofloxacin selection pressure led to the evolution of BKC-adapted populations (MIC: 100 mg BKC l-1). Efflux pump activity predominantly contributed to the developed phenotype of PA-29. An amino acid substitution (Val-51->Ala) in nfxB, the Mex efflux system regulator gene, was observed for PA-29. Over-expression of both MexAB-OprM and MexCD-OprJ was recorded for PA-29. Similarly, mexR, a repressor of the Mex system, was down-regulated. Competition studies were carried out in continuous culture between PA-29 and the original strain (in the presence of sub-inhibitory concentrations of BKC). Outcome of competition was influenced by the concentration of biocide used and the nature of limiting nutrient. The inclusion of 1 mg BKC l-1 in the medium feed was sufficient to select (S = 0.011) for the BKC-adapted strain in magnesium-limited culture. Conversely, the presence of 10 mg BKC l-1 in the medium supply was insufficient to select for the same organism (S = -0.017) in the glucose-limited culture. These results indicate the importance of environmental conditions on selection and maintenance of biocide-adaptation.

First report of a tetracycline-inducible gene expression system for mollicutes [CELL AND MOLECULAR BIOLOGY OF MICROBES]

Breton, M., Sagne, E., Duret, S., Beven, L., Citti, C., Renaudin, J. — Thu, 01 Oct 2009 05:01:12 PDT

Inducible promoter systems are powerful tools for studying gene function in prokaryotes but have never been shown to function in mollicutes. In this study we evaluated the efficacy of the tetracycline-inducible promoter Pxyl/tetO2 from Bacillus subtilis in controlling gene expression in two distinct mollicutes, the plant pathogen Spiroplasma citri and the animal pathogen Mycoplasma agalactiae. An S. citri plasmid carrying the spiralin gene under the control of the Pxyl/tetO2 tetracycline-inducible promoter and the TetR repressor gene under the control of a constitutive spiroplasmal promoter was introduced into the spiralin-less, S. citri mutant GII3-9a3. In the absence of tetracycline, expression of TetR almost completely abolished expression of spiralin from the xyl/tetO2 promoter. In contrast, adding tetracycline (> 50 ng ml-1) in the medium induced high level expression of spiralin. Interestingly, inducible expression of spiralin was also detected in vivo; in S. citri-infected leafhoppers fed on tetracycline containing medium and in S. citri-infected plants watered with tetracycline. A similar construct was introduced into the M. agalactiae chromosome through transposition. Tetracycline-induced expression of spiralin proved the TetR-Pxyl/tetO2 system to be functional in the ruminant pathogen, suggesting that this tetracycline-inducible promoter system might be of general use in mollicutes.

SMc01553 is the sixth acyl carrier protein in Sinorhizobium meliloti 1021 [PHYSIOLOGY AND BIOCHEMISTRY]

Thu, 01 Oct 2009 05:01:18 PDT

Acyl carrier proteins (ACPs) are required for the transfer of acyl intermediates during fatty acid and polyketide syntheses. In Sinorhizobium meliloti 1021 there are 5 known ACPs: AcpP, NodF, AcpXL, the ACP domain in RkpA and SMb20651. The genome sequence of S. meliloti 1021 also reveals the ORF SMc01553 annotated as putative ACP. Gene smc01553 is part of a 6.6 kb DNA region that is duplicated in the chromosome and in the pSymb plasmid which is the result of a recent duplication event. SMc01553 overexpressed in E. coli was labelled in vivo with [3H]β-alanine, a biosynthetic building block of the 4'-phosphopantetheine prosthetic group of ACPs. The purified SMc01553 was modified with 4'-phosphopantetheine in the presence of S. meliloti holo-ACP synthase and this modification resulted in a major conformational change of the protein structure, since the holo-form runs faster in native PAGE than the apo-form. SMc01553 could not be loaded with a malonyl group by malonyl CoA-ACP transacylase from S. meliloti. Using RT-PCR we could show the presence of mRNA for SMc01553 and of the duplicated ORF SMb22007 in cultures of S. meliloti. However, a mutant in which the two duplicated regions were deleted did not show any different phenotype with respect to the wild type in the free-living or symbiotic life style.

Nutrient-starved, non-replicating Mycobacterium tuberculosis requires respiration, ATP synthase and isocitrate lyase for maintenance of ATP homeostasis and viability [PHYSIOLOGY AND BIOCHEMISTRY]

Gengenbacher, M., Rao, S. P. S., Pethe, K., Dick, T. — Thu, 01 Oct 2009 05:01:17 PDT

The ability of Mycobacterium tuberculosis to persist in its human host despite extensive chemotherapy is thought to be based on sub-populations of non-replicating phenotypically drug resistant bacilli. To study the non-growing pathogen, culture models that generate quiescent organisms by either oxygen depletion in nutrient-rich medium (Wayne model) or nutrient deprivation in oxygen-rich medium (Loebel model) were developed. In contrast to the energy metabolism of Wayne bacilli, little is known about Loebel bacilli. Here we analyze M. tuberculosis under nutrient starvation conditions. Upon shifting to the non-replicating state the pathogen maintained a 5-fold reduced but constant intracellular ATP level. Chemical probing of the F0F1 ATP synthase demonstrated the importance of this enzyme for ATP homeostasis and viability of the nutrient-starved organism. Surprisingly, the specific ATP synthase inhibitor TMC207 did not affect viability and only slightly reduced the intracellular ATP level of nutrient-starved organisms. Depletion of oxygen killed Loebel bacilli, whereas death was prevented by nitrate suggesting that respiration and an exogenous electron acceptor are required for maintaining viability. Nutrient-starved bacilli lacking the glyoxylate shunt enzyme isocitrate lyase failed to reduce their intracellular ATP level and died, thus establishing a link between ATP control and the intermediary metabolism. We conclude that ATP level reduction might be an important step in the adaptation of M. tuberculosis to non-growing survival.

DsbL and DsbI Contribute to Periplasmic Disulfide Bond Formation in Salmonella enterica serovar Typhimurium [CELL AND MOLECULAR BIOLOGY OF MICROBES]

Lin, D., Kim, B., Slauch, J. M — Thu, 01 Oct 2009 05:01:13 PDT

Disulfide bond formation in periplasmic proteins is catalyzed by the DsbA/DsbB system in most Gram-negative bacteria. Salmonella enterica serovar Typhimurium also encodes a paralogous pair of proteins to DsbA and DsbB, DsbL and DsbI, respectively, downstream of a periplasmic arylsulfate sulfotransferase (ASST). We show that DsbL and DsbI function as a redox pair contributing to periplasmic disulfide bond formation and, as such, affect transcription of the SPI1 type three secretion system genes and activation of the RcsCDB system, as well as ASST activity. In contrast to DsbA/DsbB, however, the DsbL/DsbI system cannot catalyze disulfide bond formation required for flagellar assembly. Phylogenic analysis suggests that the assT dsbL dsbI genes are ancestral in the Enterobacteriaceae, but have been lost in many lineages. Deletion of assT confers no virulence defect during acute Salmonella infection of mice.

Evidence for Dicer-dependent RNA interference in the industrial penicillin producer Penicillium chrysogenum [SPECIAL ISSUE PAPER]

Janus, D., Hoff, B., Kuck, U. — Thu, 01 Oct 2009 05:01:11 PDT

RNA interference (RNAi) is a sequence-specific post-transcriptional gene silencing system that downregulates target gene expression. Here, we provide several lines of evidence for RNA silencing in the industrial β-lactam antibiotic producer Penicillium chrysogenum using the DsRed reporter gene under the control of the constitutive trpC promoter or the inducible xylP promoter. The functional RNAi system was verified by detection of siRNAs that hybridize exclusively with gene-specific ³²P-labeled RNA probes. Moreover, when RNAi was used to silence the endogenous PcbrlA morphogene that controls fungal conidiophore development, a dramatic reduction in the formation of conidiospores was observed in 47 % of the corresponding transformants. Finally, evidence that RNAi in P. chrysogenum is dependent on a Dicer peptide was provided with a strain lacking the Pcdcl2. In the Pcdcl2 background, silencing of the PcbrlA gene, controlling conidiophores development, was tested. None of the analyzed transformants showed a developmental defect. The applicability of the RNAi system in P. chrysogenum was finally demonstrated by silencing the Pcku70 gene to increase homologous recombination frequency. This led to the generation of single and double knockout mutants.

Volatile antimicrobials from Muscodor crispans, a novel endophytic fungus [PHYSIOLOGY AND BIOCHEMISTRY]

Mitchell, A. M., Strobel, G. A., Moore, E., Robison, R., Sears, J. — Thu, 01 Oct 2009 05:01:16 PDT

Muscodor crispans is a recently described novel endophytic fungus of Ananas ananassoides (wild pineapple) growing in the Bolivian Amazon Basin. The fungus produces a mixture of volatile organic compounds (VOCs), and some of the major components of this mixture are: propanoic acid, 2-methyl-, methyl ester; propanoic acid, 2-methyl- ; 1-butanol, 3-methyl-;1-butanol, 3-methyl-, acetate ; propanoic acid, 2-methyl-, 2-methylbutyl ester ; and ethanol and as determined by gas chromatography/mass spectrometry (GC/MS). The fungus does not, however, produce naphthalene or azulene derivatives as has been observed with many other members of the Muscodor genus. This mixture of fungal VOCs possesses antibiotic properties, both in culture as well as artificial mixtures of a majority of the components. The VOCs of the fungus are effective against a plethora of plant pathogens, including Pythium ultimum, Phytophthora cinnamomi, Sclerotinia sclerotiorum, Mycosphaerella fijiensis (the black sigatoka pathogen of bananas) and the serious bacterial pathogen of citrus- Xanthomonas axonpodis pv.citri. In addition, the VOCs of M. crispans killed several human pathogens, including Yersinia pestis, Mycobacterium tuberculosis, and Staphylococcus auerus. Furthermore, artificial mixtures of the fungal VOCs were both inhibitory and lethal to human and plant pathogens including several drug resistant strains of Mycobacterium tuberculosis. The gaseous products of M. crispans potentially could prove to be beneficial in the fields of medicine, agriculture, and industry.

Molecular evidences favouring step-wise evolution of Mozambique Vibrio cholerae O1 El Tor hybrid strain [ENVIRONMENTAL AND EVOLUTIONARY MICROBIOLOGY]

Halder, K., Das, B., Nair, G. B., Bhadra, R. K. — Thu, 01 Oct 2009 05:01:14 PDT

The ctxAB operon coding cholera toxin (CT) in Vibrio cholerae, is carried by the genome of a filamentous phage CTX. Usually, specific CTX infects each of the two important biotypes, classical and El Tor, of epidemic V. cholerae strains belonging to serogroup O1, which are called CTX^class and CTX^ET, respectively. However, an unusual hybrid El Tor strain carrying CTX^class caused cholera epidemic in Mozambique in 2004. To understand its evolution, we have further analyzed some representative hybrid El Tor strains isolated in Kolkata, India in 1992 and the results indicate that both the Mozambique and Indian strains are infected with a unique CTX^class having only 4 copies of tandem heptamer repeat sequence, 5'-TTTTGAT-3', present in the ctxAB promoter (P_ctxAB) region, like in CTX^ET. Usually the (P_ctxAB)of classical biotype contains 7-8 copies of the heptamer sequences. However, sequence analyses of the (P_ctxAB)regions of several classical strains indicated that the copy number of heptamer repeat sequences might vary from 4-8 copies, which was previously unknown. Since the hybrid strains analyzed in this study carry 4 copies of the heptamer sequences it may thus serve as a marker to trace the strain in future. Interestingly, while the Mozambique strain is devoid of El Tor specific free RS1 element or pre-CTX prophage, the Indian hybrid strains carried such elements. The free RS1 has been mapped, cloned and sequenced. Like pre-CTX and CTX prophages, multiple copies of free RS1 elements were found to be integrated in the large chromosomal dif site. Since Indian hybrid El Tor strains carry either free RS1 or pre-CTX prophage in their large chromosomes, it may be possible that the Mozambique hybrid El Tor strain has evolved from these progenitor strains by step-wise deletion of CTX genetic elements from their large chromosomes.

E. coli heat shock proteins, IbpA and IbpB, affect biofilm formation by influencing the level of extracellular indole [CELL AND MOLECULAR BIOLOGY OF MICROBES]

Kuczynska-Wisnik, D., Matuszewska, E., Laskowska, E. — Thu, 01 Oct 2009 05:01:13 PDT

Development of E. coli biofilm requires differential expression of various genes implicated in cell signaling, stress responses, motility, and synthesis of structures responsible for cell attachment. The ibpAB operon belongs to the stress response genes most induced during growth of E. coli biofilm. We demonstrated for the first time that the lack of IbpAB proteins in E. coli cells inhibited the formation of biofilm, although allowed normal planktonic growth. We showed that ibpAB cells experienced endogenous oxidative stress which might result from a decreased catalase activity. The endogenous oxidative stress in ibpAB cells led to increased expression of tryptophanase, an enzyme which catalyzes synthesis of indole. We demonstrated that the formation of ibpAB biofilm was delayed due to the increase in the extracellular concentration of indole, which is known to play a role of a signal molecule, inhibiting biofilm growth.

Expression of phosphofructokinase in Neisseria meningitidis [GENES AND GENOMES]

Thu, 01 Oct 2009 05:01:15 PDT

Neisseria meningitidis serogroup B is a pathogen that can infect diverse sites within the human host. According to the N. meningitidis genomic information and experimental observations glucose can be completely catabolized through the Entner-Douderoff pathway and the pentose phosphate pathway. The Embden-Meyerhof-Parnas pathway is not functional, because the gene for phosphofructokinase is not present. The phylogenetic distribution of phosphofructokinase indicates that in most obligate aerobic organisms PFK is lacking. We conclude that this is because of the limited contribution of PFK to the energy supply in aerobically grown organisms in comparison with the energy generated through oxidative phosphorylation. Under anaerobic or microaerobic conditions the available energy is limiting and PFK provides an advantage, which explains the presence of PFK in many (facultative) anaerobic organisms. In accordance with this, in silico flux balance analysis predicted an increase of biomass yield as a result of PFK expression. However, analysis of a genetically engineered N. meningitidis strain that expresses a heterologous phosphofructokinase showed that the yield of biomass on substrate decreased in comparison with a pfkA deficient control strain which was associated mainly by an increase in CO₂ production, whereas production of by-products was comparable between the two strains. This might explain why the pfkA gene is not obtained by horizontal gene transfer, since it is initially unfavourable for biomass yield. No large effects related to heterologous expression pfkA were observed in the transcriptome. Although our results suggest that introduction of PFK does not contribute to a more efficient strain in terms of biomass yield, achievement of a robust, optimal metabolic network that enables a higher growth rate or a higher biomass yield, might be possible after adaptive evolution of the strain, which remains to be investigated.

Autophagy-deficient Schizosaccharomyces pombe mutants undergo partial sporulation during nitrogen starvation [CELL AND MOLECULAR BIOLOGY OF MICROBES]

Thu, 24 Sep 2009 05:00:55 PDT

Autophagy is triggered when organisms sense radical environmental changes including nutritional starvation. During autophagy, cytoplasmic components including organelles are enclosed within autophagosomes and are degraded upon lysosome/vacuole fusion. In the present study, we show that processing of GFP-tagged Atg8 can serve as a marker for autophagy in Schizosaccharomyces pombe. Using this marker, 13 Atg homologs were also found to be required for autophagy in fission yeast. In budding yeast, autophagy-deficient mutants are known to be sterile, whereas in fission yeast we found that up to 30% of autophagy-defective cells with amino acid auxotrophy were able to recover sporulation when an excess of required amino acid compounds was supplied. Furthermore, we found that approximately 15% of the autophagy-defective cells were also able to sporulate when a prototroph strain was exposed to nitrogen starvation, which suggested that fission yeast may store sufficient intracellular nitrogen to allow partial sporulation under nitrogen-limiting conditions, although the majority of the nitrogen source is supplied by autophagy. Monitoring of the sporulation process revealed that the process was blocked nonspecifically at various stages in the atg1 and atg12 mutants, possibly due to a shortage of amino acids. Taking advantage of this partial sporulation ability of fission yeast, we tried to reveal the existence of a recycling system for nitrogen sources during starvation.

Remnant signal peptides on non-exported enzymes: implications for the evolution of prokaryotic respiratory chains [PHYSIOLOGY AND BIOCHEMISTRY]

Thu, 24 Sep 2009 05:00:54 PDT

The twin-arginine translocation (Tat) pathway is a prokaryotic protein targeting system dedicated to the transmembrane translocation of folded proteins. Substrate proteins are directed to the Tat translocase by signal peptides bearing a conserved SRRxFLK ‘twin-arginine’ motif. In Escherichia coli, most of the 27 periplasmically-located Tat substrates are cofactor-containing respiratory enzymes, and many of these harbour a molybdenum cofactor at their active site. Molybdenum cofactor-containing proteins are not exclusively located in the periplasm, however, with the major respiratory nitrate reductase (NarG), and the biotin sulfoxide reductase (BisC), for example, being located at the cytoplasmic side of the membrane. Interestingly, both NarG and BisC contain ‘N-tail’ regions that bear some sequence similarity to twin-arginine signal peptides. In this work, we have examined the relationship between the non-exported N-tails and the twin-arginine transport system. Using a sensitive genetic screen for Tat transport, variant N-tails were identified that displayed Tat transport activity. For the NarG 36 residue N-tail, six amino acid changes were needed to induce transport activity. However, these changes interfered with binding by the NarJ biosynthetic chaperone and impaired biosynthesis of the native enzyme. For the BisC 36 residue N-tail, only five amino acid substitutions were needed to restore Tat transport activity to this peptide. These modifications also impaired in vivo BisC activity, but it was not possible to identify a biosynthetic chaperone for this enzyme. These data highlight an intimate genetic and evolutionary link between some non-exported redox enzymes and those transported across membranes by the Tat translocation system.

A distinct physiological role of MutY in mutation prevention in mycobacteria [PHYSIOLOGY AND BIOCHEMISTRY]

Thu, 24 Sep 2009 05:00:54 PDT

The oxidative damages to DNA result in the occurrence of 7, 8-dihydro-8-oxoguanine (8-oxoG) in the genome. In eubacteria, repair of such damages is initiated by two major base excision repair enzymes, MutM and MutY. We generated a MutY deficient strain of M. smegmatis to investigate its role in DNA repair. The MutY deficiency in M. smegmatis did not result in either a noteworthy susceptibility to oxidative stress or an increase in the mutation rate. However, the rifampicin resistant isolates of the MutY deficient strain showed distinct mutations in the rifampicin resistance determining region of rpoB. Besides the expected C to A (or G to T) mutations, an increase in A to C (or T to G) mutations was also observed. Biochemical characterization of mycobacterial MutY (M. smegmatis and M. tuberculosis) revealed an expected excision of A opposite 8-oxoG in DNA. Additionally, a detectable excision of G and T opposite 8-oxoG was noted. The MutY formed complexes with DNA containing 8-oxoGxA, 8-oxoGxG or 8-oxoGxT but not 8-oxoGxC pairs. The primer extension reactions in M. smegmatis cell-free extracts suggested error-prone incorporation of nucleotides in DNA. Based on these observations, we discuss the physiological role of MutY in specific mutation prevention in mycobacteria.

SLA2 mutations cause SWE1-mediated cell cycle phenotypes in Candida albicans and Saccharomyces cerevisiae [SPECIAL ISSUE PAPER]

Thu, 24 Sep 2009 05:00:55 PDT

The early endocytic patch protein Sla2 is important for morphogenesis and growth rates in Saccharomyces cerevisiae and Candida albicans, but the mechanism that connects these processes is not clear. Here we report that growth defects in cells lacking CaSLA2 or ScSLA2 are associated with a cell cycle delay that is influenced by Swe1, a morphogenesis checkpoint kinase. To establish how Swe1 monitors Sla2 function, we compared actin organization and cell cycle dynamics in strains lacking other components of early endocytic patches (Sla1 and Abp1) with strains lacking Sla2. Only sla2 strains had defects in actin cables, a known trigger of the morphogenesis checkpoint, yet all three strains exhibited Swe1-dependent phenotypes. Thus, Swe1 appears to monitor actin patch in addition to actin cable function. Furthermore, Swe1 contributed to virulence in a mouse model of disseminated candidiasis, implicating a role for the morphogenesis checkpoint during the pathogenesis of C. albicans infections.

A broad host range flagellum-dependent phage mediates high-efficiency generalized transduction in, and between, Serratia and Pantoea [GENES AND GENOMES]

Thu, 24 Sep 2009 05:00:56 PDT

A phage (OT8) isolated on Serratia sp. ATCC 39006 was shown to be flagellum-dependent and to mediate generalized transduction with high efficiency (up to 10^-4 transductants per p.f.u.). OT8 has a broad host range because it also infects a strain of Pantoea agglomerans isolated from the rhizosphere. Transduction of plasmid-borne antibiotic resistance between these two bacterial genera was demonstrated, consistent with purported ecological roles of phages in dissemination of genes between bacterial genera. Serratia sp. ATCC 39006 and Pantoea agglomerans produce a number of interesting secondary metabolites with potential applications in cancer therapy and biocontrol of fungal infections. OT8 has utility as a powerful functional genomics tool in these bacteria.

AI-2 quorum sensing inhibitors affect the starvation response and reduce virulence in several Vibrio species, most likely by interfering with LuxPQ [MICROBIAL PATHOGENICITY]

Thu, 24 Sep 2009 05:00:55 PDT

The increase of disease outbreaks caused by Vibrio spp. in aquatic organisms as well as in humans, together with the emergence of antibiotic resistance in Vibrio spp., has led to a growing interest in alternative disease control measures. Quorum sensing (QS) is a mechanism for regulating microbial gene expression in a cell-density dependent way. While there is good evidence for the involvement of auto-inducer 2 (AI-2) based interspecies QS in the control of virulence in multiple Vibrio spp., only few inhibitors of this system are known. From the screening of a small panel of nucleoside analogues for their ability to disturb AI-2 based QS, an adenosine derivative with a p-methoxyphenylpropionamide moiety at C-3', emerged as a promising hit. Its mechanism of inhibition was elucidated by measuring the effect on bioluminescence in a series of Vibrio harveyi AI-2 QS mutants. Our results indicate that this compound, as well as a truncated analogue lacking the adenine base, block AI-2 based QS without interfering with bacterial growth. The active compounds neither affected the bioluminescence system as such, nor the production of AI-2, but most likely interfered with the signal transduction pathway at the level of LuxPQ in V. harveyi. The most active nucleoside analogue (designated LMC-21) was found to reduce Vibrio spp. starvation response, to affect biofilm formation in Vibrio anguillarum, Vibrio vulnificus and Vibrio cholerae, to reduce pigment and protease production in V. anguillarum and to protect gnotobiotic Artemia from V. harveyi-induced mortality.

PhPssA is required for alpha-amylase secretion in Antarctic Pseudoalteromonas haloplanktis [CELL AND MOLECULAR BIOLOGY OF MICROBES]

Parrilli, E., Giuliani, M., Pezzella, C., Danchin, A., Marino, G., Tutino, M. L. — Thu, 24 Sep 2009 05:00:53 PDT

Extracellular protein secretion is an essential feature in bacterial physiology. The ability to efficiently secrete diverse hydrolytic enzymes represents a key nutritional strategy for all bacteria also for microorganisms living in extreme and hostile habitats, such as cold environments. However, little is known about protein secretion mechanisms occurring in psychrophilic bacteria. In this paper, the recombinant secretion of a psychrophilic -amylase in the Antarctic Gram-negative Pseudoalteromonas haloplanktis TAC125 was investigated. By a combination of several molecular techniques, the function of pssA gene was related to -amylase secretion in the psychrophilic bacterium. pssA gene deletion completely abolished the amylase secretion without affecting the extracellular targeting of other substrates mediated by canonical secretion systems. The pssA gene product, PssA, is a multidomain lipoprotein, predicted to be localized into the bacterial outer membrane, and displaying three TPR (Tetratrico Peptide Repeat) domains and two LysM modules. Relying on functional annotation of these domains, combined with the experimental results reported herein, we have suggested a role for PssA as a molecular adaptor, in charge of recruiting other cellular components required for specific -amylase secretion. To the best of our knowledge, no proteins exhibiting the same domain organization have ever been linked to protein secretion.

Null mutation analysis of an afsA-family gene, barX, that is involved in biosynthesis of the {gamma}-butyrolactone autoregulator in Streptomyces virginiae [CELL AND MOLECULAR BIOLOGY OF MICROBES]

Lee, Y. J., Kitani, S., Nihira, T. — Thu, 24 Sep 2009 05:00:53 PDT

Virginiae butanolide (VB) is a -butyrolactone autoregulator triggering production of the streptogramin antibiotic virginiamycin in Streptomyces virginiae. Our previous studies suggested that the barX gene, an afsA-family gene, is likely to participate in the regulatory pathway for the production of VB, rather than in the biosynthetic pathway of VB itself, in contrast to the function of other afsA-family genes. Mutation analysis now shows that BarX at least plays an enzymatic role in the VB biosynthetic pathway. Heterologous expression of the afsA gene from Streptomyces griseus into the barX mutant partially restored the deficiency of virginiamycin production, suggesting that afsA-family genes have a common ability to synthesize the -butyrolactone autoregulators. Taken together with previous works relating the function of an afsA-family gene, these results supported an idea that streptomycetes has two biosynthetic pathways for the -butyrolactone autoregulators.

The role of PvdQ in Pseudomonas aeruginosa virulence under iron limiting conditions [CELL AND MOLECULAR BIOLOGY OF MICROBES]

Thu, 24 Sep 2009 05:00:52 PDT

PvdQ, an acylase from Pseudomonas aeruginosa PAO1, has been shown to have at least two functions. It can act as a quorum quencher in the light of its capability to degrade long-chain acyl homoserine lactones (AHLs) e.g. 3-oxo-C12-HSL, leading to a decrease in virulence factors. In addition, PvdQ is involved in iron homeostasis by playing a role in the biosynthesis of pyoverdine, the major siderophore of P. aeruginosa. In accordance with earlier studies on RNA level, we could show at protein level that PvdQ is only expressed when iron is present at very low concentrations. Consequently, we have set out to investigate the two functions of PvdQ under iron limiting conditions. Gene deletion of pvdQ does not affect growth of P. aeruginosa but abrogates pyoverdine production, and results in an accumulation of 3-oxo-C12-HSL. Phenotypical analyses of our deletion mutant at low iron concentrations revealed that _pvdQ is impaired in swarming motility and biofilm formation. Additionally, a plant and a C. elegans infection model demonstrated that the deletion of pvdQ resulted in reduced virulence. None of the phenotypes in the present study could be linked to the presence or absence of AHLs. These results clearly indicate that under iron limiting conditions PvdQ plays a major role in swarming motility, in biofilm development and in infection that is more likely to be linked to the pyoverdine pathway rather than the LasI/LasR/3-oxo-C12-HSL quorum sensing circuit.

A tyrosine O-prenyltransferase catalyses the first pathway-specific step in the biosynthesis of sirodesmin PL [PHYSIOLOGY AND BIOCHEMISTRY]

Kremer, A., Li, S.-M. — Thu, 17 Sep 2009 05:31:23 PDT

A putative prenyltransferase gene sirD was identified in the biosynthetic gene cluster of the phytotoxin sirodesmin PL in Leptosphaeria maculans. The gene product comprises 449 amino acids with a molecular mass of 51 kDa. In this study, the coding region of sirD was amplified by PCR from cDNA, cloned into pQE70 and overexpressed in Escherichia coli. The overproduced protein was purified to apparent homogeneity and characterised biochemically. The dimeric recombinant SirD was found to catalyse the O-prenylation of L-tyrosine in the presence of dimethylallyl diphosphate, which was proven unequivocally by isolation and structural elucidation of the enzymatic product. Therefore, SirD catalyses the first pathway-specific step in the biosynthesis of sirodesmin PL. KM values for L-tyrosine and dimethylallyl diphosphate were determined as 0.13 and 0.17 mM, respectively. Interestingly, SirD shares significant sequence similarity with indole prenyltransferases, which catalyse prenyl transfer reactions onto different positions of indole rings. In contrast to indole prenyltransferases, which accepted indole derivatives, but not tyrosine or structures derived thereof as substrates, SirD prenylated also L-tryptophan resulting in formation of 7-dimethylallyltryptophan. A KM value of 0.23 mM was determined for L-tryptophan. Turnover numbers were calculated for L-tyrosine and L-tryptophan at 1.0 and 0.06 S-1, respectively.

Development of a non-invasive murine infection model for acute otitis media [MICROBIAL PATHOGENICITY]

Thu, 17 Sep 2009 05:31:24 PDT

Otitis Media (OM) is one of the most frequent diseases in childhood, and Streptococcus pneumoniae is among the main causative bacterial agents. Since current experimental models used to study the bacterial pathogenesis of OM have several limitations, such as the invasiveness of the experimental procedures, we developed a non-invasive murine OM model. In our model, a pressure cabin is used in which a 40kPa pressure increase is applied to translocate pneumococci from the nasopharyngeal cavity into both mouse middle ears. This model was adapted from a previously developed rat OM model. Wild-type pneumococci were found to persist in the middle ear cavity for 144 hours after infection, with a maximum bacterial load at 96 hours. Inflammation was confirmed at 96 and 144 hours post infection by IL-1β and TNF- cytokine analysis and histopathology. Subsequently, we investigated the contribution of two surface-associated pneumococcal proteins, the streptococcal lipoprotein rotamase A (SlrA) and the putative proteinase maturation protein A (PpmA) to experimental OM in our model. Pneumococci lacking the gene encoding SlrA, but not PpmA were significantly reduced in virulence in the otitis media model. Importantly, pneumococci lacking both genes were significantly more attenuated than the slrA single mutant. This additive effect suggests that SlrA and PpmA exert complementary functions during experimental OM. In conclusion, we have developed a highly reproducible and non-invasive murine infection model for pneumococcal OM using a pressure cabin, which is very suitable to study pneumococcal pathogenesis and virulence in vivo.

Biochemical and Genomic Analysis of the Denitrification Pathway within Neisseria species [GENES AND GENOMES]

Barth, K. R., Isabella, V. M, Clark, V. L — Thu, 17 Sep 2009 05:31:22 PDT

Since N. gonorrhoeae and N. meningitidis are obligate human pathogens, a comparison to commensal species of the same genus could reveal differences important in pathogenesis. The recent completion of commensal Neisseria genome draft assemblies allowed us to perform a comparison of the genes involved in the catalysis, assembly, and regulation of the denitrification pathway, which has been implicated in the virulence of several bacteria. All species contained a highly conserved nitric oxide reductase (NorB) and a nitrite reductase (AniA or NirK) that was highly conserved in the catalytic but divergent in the N-terminal lipid modification and C-terminal glycosylation domains. Only N. mucosa contained a nitrate reductase (Nar) and only N. lactamica, N. cinerea, N. subflava, N. flavescens, and N. sicca contained a nitrous oxide reductase (Nos) complex. The regulators of the denitrification genes, FNR, NarQP, and NsrR were highly conserved except for the GAF domain of NarQ. Biochemical examination of laboratory strains revealed that all of the neisserial species tested except N. mucosa had a 2-4 fold lower nitrite reductase activity than N. gonorrhoeae, while N. meningitidis and most of the commensal Neisseria species had a 2-4 fold higher nitric oxide (NO) reductase activity. For N. meningitidis and most of the commensal Neisseria, there was a greater than 4-fold reduction in the NO steady state level in the presence of nitrite as compared to N. gonorrhoeae. All of the species tested generated a NO steady state level in the presence of a NO donor that was similar to that of N. gonorrhoeae. The greatest difference between the Neisseria spp. was the lack of a functional Nos system in the pathogenic species N. gonorrhoeae and N. meningitidis.

Influence of Type IV Pilus Retraction on the Architecture of the N. gonorrhoeae-Infected Cell Cortex [MICROBIAL PATHOGENICITY]

Thu, 17 Sep 2009 05:31:25 PDT

Early in infection, Neisseria gonorrhoeae can be observed to attach to the epithelial cell surface as microcolonies and induce dramatic changes to the host cell cortex. We tested the hypothesis that Tfp retraction plays a role in the ultrastructure of both the host cell cortex and bacterial microcolony. Using serial ultra-thin sectioning, Transmission Electron Microscopy and 3D reconstruction of serial 2D images, we have obtained the first 3D reconstructions of the N. gonorrhoeae-host cell interface, and determined the architecture of infected cell microvilli as well as the attached microcolony. Tfp connect both wt and Tfp-retraction-deficient bacteria with each other, and with the host cell membrane. Tfp fibers and microvilli form a lattice in the wt microcolony and at its periphery. Wt microcolonies induce microvillus formation and surface area increases, leading to a ~9-fold increase in the surface area of the host cell membrane at the site of attachment. In contrast, Tfp-retraction-deficient microcolonies did not affect these parameters. Wt microcolonies had a symmetrical, dome-shaped structure with a circular "footprint" while Tfp-retraction-deficient microcolonies were notably less symmetrical. These findings support a major role for Tfp retraction in microvillus and microcolony architecture. They are consistent with the biophysical attributes of Tfp and the effects of Tfp retraction on epithelial cell signaling.

Transcriptional regulation of the novobiocin biosynthetic gene cluster [PHYSIOLOGY AND BIOCHEMISTRY]

Thu, 17 Sep 2009 05:31:21 PDT

The aminocoumarin antibiotic novobiocin is a gyrase inhibitor formed by a Streptomyces strain. The biosynthetic gene cluster of novobiocin spans 23.4 kb and comprises 20 coding sequences, among them the two regulatory genes novE and novG. We now investigated the location of transcriptional promoters within this cluster by insertion of transcriptional terminator cassettes and reverse transcriptase-PCR analysis of the resulting mutants. The cluster was found to contain eight DNA regions with promoter activity. The regulatory protein NovG binds to a previously identified binding site within the promoter region located upstream of novH, but apparently not to any of the other seven promoters. Quantitative real-time PCR was now used to compare the number of transcripts in a strain carrying an intact novobiocin cluster with strains carrying mutated clusters. Both in-frame deletion of the regulatory gene novG or insertion of a terminator cassette into the biosynthetic gene novH led to a strong reduction of the number of transcripts of the genes located between novH and novW. This suggested that these sixteen biosynthetic genes form a single operon. Three internal promoters are localized within this operon but appear to be of minor importance, if any, under our experimental conditions. Transcription of novG was found to depend on the presence of NovE, suggesting that the two regulatory genes novE and novG act in a cascade-like mechanism. The resistance gene gyrBR, coding for an aminocoumarin-resistant gyrase B subunit, may initially be co-transcribed with the genes from novH to novW. However, when the gyrase inhibitor novobiocin accumulates in the cultures, gyrBR is transcribed from its own promoter. Previous work suggested that this promoter may be controlled by the superhelical density of chromosomal DNA.

Differential expression of Salmonella Type III secretion system factor InvJ, PrgJ, SipC, SipD, SopA, and SopB in cultures and in mice [CELL AND MOLECULAR BIOLOGY OF MICROBES]

Gong, H., Vu, G.-P., Bai, Y., Yang, E., Liu, F., Lu, S. — Thu, 17 Sep 2009 05:31:24 PDT

The type III secretion system (T3SS) encoded by Salmonella pathogenicity island 1 (SPI-1) is important for invasion of epithelial cells during development of Salmonella-associated enterocolitis. It has been suggested that the level and timing of the expression of the SPI-1 T3SS proteins and effectors dictate the consequences of bacterial infection and pathogenesis. However, the expression of these proteins has not been extensively studied in vivo, especially during the later stages of salmonellosis when the infection is established. We have constructed recombinant Salmonella strains that contain a FLAG epitope inserted in frame to genes invJ, prgJ, sipC, sipD, sopA, and sopB, and investigated the expression of the tagged proteins both in vitro and in vivo during murine salmonellosis. Mice were inoculated intraperitoneally or intragastrically with the tagged Salmonella strains. At different time points post-infection, bacteria were recovered from various organs, and the expression of the tagged proteins was determined. Our results provide direct evidence that PrgJ and SipD are expressed in Salmonella colonizing the liver and ileum of infected animals at both the early and late stages of infection. Furthermore, our study has shown for the first time that the InvJ protein is expressed preferably in Salmonella colonizing the ileum but not the liver while SipC is expressed preferably in Salmonella colonizing the liver but not the ileum. Thus, Salmonella appears to express different SPI-1 proteins and effectors when they colonize specific tissues. Our results suggest that differential expression of these proteins may be important for tissue-specific aspects of bacterial pathogenesis such as gastroenterititis in the ileum and systemic infection in the liver.

The Azospirillum brasilense Sp7 noeJ and noeL genes are involved in extracellular polysaccharide biosynthesis [ENVIRONMENTAL AND EVOLUTIONARY MICROBIOLOGY]

Thu, 17 Sep 2009 05:31:20 PDT

AAzospirillum brasilense is a plant root colonizing bacterium that exerts beneficial effects on growth of many agricultural crops. Extracellular polysaccharides of the bacterium play an important role in its interactions with plant roots. The pRhico plasmid of A. brasilense Sp7- also named p90- carries several genes involved in synthesis and export of cell surface polysaccharides. We generated two Sp7 mutants impaired in two pRhico-located genes, noeJ and noeL, encoding mannose-6-phosphate isomerase and GDP-mannose 4,6-dehydratase, respectively. Our results demonstrate that in A. brasilense Sp7, noeJ and noeL are involved in lipopolysaccharide and exopolysaccharide synthesis. noeJ and noeL mutant strains were significantly altered in their outer membrane and cytoplasmic/periplasmic protein profiles relative to the wild-type strain. Moreover, both noeJ and noeL mutations significantly affected the bacterial responses to several stresses and antimicrobial compounds. Disruption of noeL but not noeJ affected the ability of the A. brasilense Sp7 to form biofilms. The pleiotropic alterations observed in the mutants could be due, at least partially, to their altered lipopolysaccharides and exopolysaccharides relative to the wild type.

RelA regulates virulence and intracellular survival of Francisella novicida [CELL AND MOLECULAR BIOLOGY OF MICROBES]

Dean, R. E., Ireland, P. M., Jordan, J. E., Titball, R. W., Oyston, P. C.F. — Thu, 17 Sep 2009 05:31:20 PDT

Analysis of the genome of Francisella tularensis revealed few regulatory systems and how the organism adapts to conditions in different niches is poorly understood. The stringent response is a global stress response mediated by (p)ppGpp. The enzyme RelA has been shown to be involved in generation of this signal molecule in a range of bacterial species. We investigated the effect of inactivation of the relA gene in Francisella by generating a mutant in Francisella novicida. Under amino acid starvation conditions, the relA mutant was defective for (p)ppGpp production. Characterisation showed the mutant to grow similarly to the wild type, except that it entered stationary phase later than wild type cultures, resulting in higher cell yields. The relA mutant showed increased biofilm formation which may be linked to the delay in entering stationary phase which would result in higher cell numbers present in the biofilm, and reduced resistance to in vitro stress. The mutant was attenuated in the J774A macrophage cell line and was shown to be attenuated in the mouse model of tularaemia, but able to induce a protective immune response. Therefore, (p)ppGpp appears to be an important intracellular signal, integral to the pathogenesis of F. novicida.

Deletion of Mid1, a putative stretch-activated calcium channel in Claviceps purpurea, affects vegetative growth, cell wall synthesis and virulence [SPECIAL ISSUE PAPER]

Bormann, J., Tudzynski, P. — Thu, 17 Sep 2009 05:31:23 PDT

The putative Claviceps purpurea homologue of the Saccharomyces cerevisiae stretch-activated calcium ion channel Mid1 was investigated for its role in vegetative growth, differentiation and pathogenicity on Secale cereale. Gene replacement mutants of C. purpurea mid1 were not affected in polar growth and branching in axenic culture but showed a significantly reduced growth rate. The growth defect could not be complemented by Ca2+ supplementation, in contrast to mid1 mutants in yeast, but altered sensitivity of the mutants towards changes in external and internal Ca2+-concentrations indicate some role of Mid1 in Ca2+ homoeostasis. The major effect of mid1 deletion, however, was the complete loss of virulence: infected rye plants show no disease symptoms at all. Detailed analyses of in vitro infected rye ovaries demonstrate that the mid1 mutants show multiple apical branches and are unable to infect the host tissue, suggesting that Mid1 is essential for generating the necessary mechanical force for penetration. This is the first report on an essential role of a Mid1 homologue in virulence of a plant pathogenic fungus.

Functional analyses of PAU genes in Saccharomyces cerevisiae [GENES AND GENOMES]

Luo, Z., van Vuuren, H. J. — Thu, 17 Sep 2009 05:31:22 PDT

PAU genes constitute the largest gene family in Saccharomyces cerevisiae with 24 members mostly located in the subtelomeric region of chromosomes. Little information is available about PAU genes, other than expression data for some members. In this study, we systematically compared the sequences of all 24 members, examined the expression of PAU3, PAU5, DAN2, PAU17 and PAU20 in response to stresses, and investigated the stability of all Pau proteins. The chromosomal localization, synteny and sequence analyses revealed that PAU genes could have been amplified by segmental and retroposition duplication through mechanisms of chromosomal end translocation and Ty-associated recombination. The coding sequences diverged through nucleotide substitution and in/del of 1 to 4 codons, thus causing changes in amino acids, truncation or extension of Pau proteins. Pairwise comparison of non-coding regions revealed little homology in flanking sequences. All 24 PAU promoters contain a TATA box, and 22 PAU promoters contain at least one copy of the anaerobic response element and the aerobic repression motif. Differential expression was observed between PAU3, PAU5, PAU17, PAU20 and DAN2 in response to stress with PAU5 having the highest capacity to be induced by anaerobic conditions, low temperature, and wine fermentations. Furthermore, Pau proteins with 124 aa were less stable than those with 120 or 122 aa. Our results indicate that duplicated PAU genes have been evolving, and the individual Pau proteins might possess specific roles for the adaptation of S. cerevisiae to certain environmental stresses.

The novel polysaccharide deacetylase homolog Pdi contributes to virulence of the aquatic pathogen Streptococcus iniae [MICROBIAL PATHOGENICITY]

Thu, 17 Sep 2009 05:31:23 PDT

The aquatic zoonotic pathogen, Streptococcus iniae, represents a threat to the worldwide aquaculture industry and poses a risk to humans who handle raw fish. Because little is known about the mechanisms of S. iniae pathogenesis or virulence factors, we established a high-throughput system combining whole genome pyrosequencing and transposon mutagenesis that allowed us to identify virulence proteins, including Pdi, the polysaccharide deacetylase of S. iniae, that we describe here. Using bioinformatics tools, we determined a highly conserved signature motif in Pdi that is also conserved in the peptidoglycan deacetylase PgdA protein family. A pdi mutant was attenuated for virulence in the hybrid striped bass model and for survival in whole fish blood. Moreover, Pdi was found to promote bacterial resistance to lysozyme killing and the ability to adhere to and invade epithelial cells. On the other hand, there was no difference in the autolytic potential, resistance to oxidative killing, or resistance to cationic antimicrobial peptides between S. iniae wild type and pdi. In conclusion, we have demonstrated that pdi is involved in S. iniae adherence and invasion, lysozyme resistance, and survival in fish blood, and have shown that pdi plays a role in the pathogensis of S. iniae. Identification of Pdi and other S. iniae virulence proteins is a necessary initial step towards the development of appropriate preventive and therapeutic measures against diseases and economical losses caused by this pathogen.

The pneumococcal response to oxidative stress includes a role for Rgg [MICROBIAL PATHOGENICITY]

Bortoni, M. E., Terra, V. S., Hinds, J., Andrew, P. W., Yesilkaya, H. — Thu, 17 Sep 2009 05:31:21 PDT

Streptococcus pneumoniae resides in the oxygen-rich environment of the upper respiratory tract, and therefore the ability to survive in the presence of oxygen is an important aspect of its in vivo survival. To investigate how S. pneumoniae adapts to oxygen, we determined the global gene expression profile of the microorganism in aerobiosis and anaerobiosis. It was found that exposure to aerobiosis elevated the expression of 54 genes, while the expression of 15 genes was down-regulated. Notably there were significant changes in putative genome plasticity and hypothetical genes. In addition, increased expression of rgg, a putative transcriptional regulator, was detected. To test Rgg's role in the pneumococcal oxidative stress response, an isogenic mutant was constructed. It was found that the mutant was sensitive to oxygen and paraquat, but not to H2O2. In addition, the absence of Rgg strongly reduced biofilm forming ability of an unencapsulated pneumococcus. Virulence studies showed that the median survival time of mice infected intranasally with the rgg mutant was significantly longer than in the wild-type infected group, and the animals infected with the mutant developed septicaemia later than those infected intranasally with the wild type.

Defects in glycopeptidolipid biosynthesis confer phage I3 resistance in Mycobacterium smegmatis [CELL AND MOLECULAR BIOLOGY OF MICROBES]

Chen, J., Kriakov, J., Singh, A., Jacobs, W. R, Besra, G. S., Bhatt, A. — Thu, 10 Sep 2009 04:01:10 PDT

Mycobacteriophages have played an important role in the development of genetic tools and diagnostics for pathogenic mycobacteria including Mycobacterium tuberculosis. However, despite the isolation of numerous phages that infect mycobacteria, the mechanisms of mycobacteriophage infection remain poorly understood and knowledge about phage receptors is minimal. In an effort to identify the receptor for phage I3, we screened a library of Mycobacterium smegmatis transposon mutants for phage resistant strains. All four phage I3-resistant mutants isolated were found to have transposon insertions in genes located in a cluster involved in the biosynthesis of the cell wall-associated glycopeptidolipid (GPL) and consequently did not synthesize GPLs. The loss of GPLs co-related specifically with phage I3 resistance as all mutants retained sensitivity to two other mycobacteriophages, D29 and BxZ1. In order to define the minimal receptor for phage I3 we then tested the phage sensitivity of previously described GPL-deficient mutants of M. smegmatis that accumulated biosynthesis intermediates of GPLs. The results indicated that, while the removal of most sugar residues from the fatty acyl tetrapeptide core (FATP) of GPL did not affect sensitivity to phage I3, a single methylated rhamnose, transferred by the rhamnosyl transferase Gtf2 to the FATP core, was critical for phage binding.

Two type IV secretion systems with different functions in Burkholderia cenocepacia K56-2 [MICROBIAL PATHOGENICITY]

Zhang, R., LiPuma, J. J., Gonzalez, C. F. — Thu, 10 Sep 2009 04:01:08 PDT

Bacterial type IV secretion systems (T4SS) perform two fundamental functions related to pathogenesis: the delivery of effector molecules to eukaryotic target cells and genetic exchange. Two T4SSs have been identified in Burkholderia cenocepacia K56-2, a representative of the ET12 lineage of the Burkholderia cepacia complex (Bcc). The Ptw T4SS encoded on a resident 92-kb plasmid is a chimera composed of VirB/D4 and F-specific subunits and is responsible for the translocation of effector(s) that have been linked to the plant tissue watersoaking (Ptw) phenotype. The bc-VirB/D4 system located on the chromosome II displays homology to the VirB/D4 T4SS of Agrobacterium tumefaciens. In contrast to the Ptw T4SS, the bc-VirB/D4 T4SS was found to be dispensable for plant watersoaking effector(s) secretion, but was found to be involved in plasmid mobilization. The fertility inhibitor Osa did not affect the secretion of watersoaking effector(s) via the Ptw system but did disrupt the mobilization of a RSF1010 derivative plasmid.

Degradation of chloroaromatics by Pseudomonas putida GJ31: assembled route for chlorobenzene degradation encoded by clusters on plasmid pKW1 and the chromosome [ENVIRONMENTAL AND EVOLUTIONARY MICROBIOLOGY]

Thu, 10 Sep 2009 04:01:09 PDT

Pseudomonas putida GJ31 has been reported to grow on chlorobenzene using a meta-cleavage pathway with chlorocatechol 2,3-dioxygenase (CbzE) as key enzyme. The CbzE encoding gene was now found to be localized on the 180-kbp plasmid pKW1 in a cbzTEXGS cluster which is flanked by transposases and encodes only a partial (chloro)catechol meta-cleavage pathway comprising ferredoxin reductase, chlorocatechol 2,3-dioxygenase, an unknown protein, 2-hydroxymuconic semialdehyde dehydrogenase and glutathione S-transferase. Downstream of cbzTEXGS, cbzJ, encoding a novel type of 2-hydroxypent-2,4-dienoate hydratase and a transposon region highly similar to Tn5501 are located. Upstream of cbzTEXGS, traNEOFG transfer genes were found. The search for gene clusters possibly completing the (chloro)catechol metabolic pathway of GJ31 revealed the presence of two additional catabolic gene clusters on pKW1. The mhpRBCDFETP cluster encodes enzymes for the dissimilation of 2,3-dihydroxyphenylpropionate in a novel arrangement characterized by the absence of a gene encoding 3-(3-hydroxyphenyl)propionate monooxygenase and the presence of a GntR-type regulator, whereas the nahINLOMKJ cluster encodes a part of the naphthalene metabolic pathway. Transcription studies supported their possible involvement in chlorobenzene degradation. The upper pathway cluster comprising genes encoding a chlorobenzene dioxygenase and a chlorobenzene dihydrodiol dehydrogenase was localized on the chromosome. High level of transcription in response to chlorobenzene revealed it to be crucial for chlorobenzene degradation. The chlorobenzene degradation pathway in strain GJ31 is thus a mosaic encoded by 4 gene clusters.

Genetic diversity and stability of the porA allele as a genetic marker in human Campylobacter infection [ENVIRONMENTAL AND EVOLUTIONARY MICROBIOLOGY]

Cody, A. J., Maiden, M. C. J., Dingle, K. E. — Thu, 10 Sep 2009 04:01:09 PDT

The major outer membrane protein (MOMP) of Campylobacter jejuni and C. coli, encoded by the porA gene, is extremely genetically diverse. Conformational MOMP epitopes are important in host immunity, and variation in surface exposed regions probably occurs as a result of positive immune selection during infection. porA diversity has been exploited in genotyping studies using highly discriminatory nucleotide sequences to identify potentially epidemiologically linked cases of human campylobacteriosis. To understand the overall nature and extent of porA diversity and stability in C. jejuni and C. coli we investigated sequences in isolates (n = 584) obtained from a defined human population (approx. 600,000) over a defined time period (1 year). A total of 196 distinct porA variants were identified. Regions encoding putative extracellular loops were the most variable in both nucleotide sequence and length. Phylogenetic analysis identified three porA allele clusters that originated in; (i) predominantly C. jejuni with a few C. coli, (ii) solely C. jejuni (iii) predominantly C. coli with a few C. jejuni. The stability of porA within an individual human host was investigated using isolates cultured longitudinally from 64 sporadic cases, 27 of which had prolonged infection lasting between 5-98 days (the remainder having illness of normal duration 0-4 days), and 20 cases from family outbreaks. Evidence of mutation was detected in two patients with prolonged illness. Despite demonstrable positive immune selection in these two unusual cases, the persistence of numerous variants within the population indicated that the porA allele is a valuable tool for use in extended typing schemes.

Genetic diversity of capsular polysaccharide biosynthesis in Klebsiella pneumoniae clinical isolates [GENES AND GENOMES]

Thu, 10 Sep 2009 04:01:08 PDT

Klebsiella pneumoniae is an enteric pathogen causing community-acquired and hospital-acquired infections in humans. Epidemiology studies have revealed significant diversity in capsular polysaccharide (CPS) type and clinical manifestation of K. pneumoniae infection in different geographical areas of the world. We have sequenced the capsular polysaccharide synthesis (cps) region of seven clinical isolates and compared the sequences with the publicly available cps sequence data of five strains: NTUH-K2044 (K1 serotype), Chedid (K2 serotype), MGH78578 (K52 serotype), A1142 (K57 serotype), and A1517. Among all strains, six genes at the 5'-end of the cps clusters that encode proteins for CPS transportation and processing in the bacterial surface are highly similar to each other. The central region of the cps gene clusters, which encodes proteins for polymerization and assembly of the CPS subunits, is highly divergent. Based on the collected sequence, we found that either the wbaP gene or the wcaJ gene exists in a given K. pneumoniae strain, suggesting that there is major difference in the CPS biosynthesis pathway and the K. pneumoniae strains can be classified into at least two distinct groups. All isolates contain gnd encoding gluconate-6-phosphate dehydrogenase at the 3'-end of the cps gene clusters. The rmlBADC genes were found in CPS K9-positive, K14-positive and K52-positive strains, while manC and manB were found in K1, K2, K5, K14, K62, and two undefined strains. Our data indicate that, while overall genomic organization is similar between different pathogenic K. pneumoniae strains, the genetic variation of the sugar moiety and polysaccharide linkage generate the diversity in CPS molecules that could help evade host immune attack.

Vesicle-associated melanization in Cryptococcus neoformans [SPECIAL ISSUE PAPER]

Eisenman, H. C, Frases, S., Nicola, A. M, Rodrigues, M. L, Casadevall, A. — Thu, 03 Sep 2009 04:01:08 PDT

Recently, several pathogenic fungi were shown to produce extracellular vesicles that contain various components associated with virulence. In the human pathogenic fungus Cryptococcus neoformans, these components included laccase, an enzyme that catalyzes melanin synthesis. Spherical melanin granules have been observed in the cell wall of C. neoformans. Given that melanin granules have dimensions that are comparable to those of extracellular vesicles, and that metazoal organisms produce melanin in vesicular structures known as melanosomes, we investigated the role of vesicles in cryptococcal melanization. Extracellular vesicles melanized when incubated with melanin precursor L-DOPA. The kinetics of substrate incoporation into cells and vesicles was analyzed using radiolabeled L-DOPA. The results indicated that substrate incorporation was different for cells and isolated vesicles. Acid-generated melanin ghosts stained with lipophilic dyes implying presence of associated lipid. A model for C. neoformans melanization is proposed that accounts for these observations and provides a mechanism for the assembly of melanin into relatively uniform spherical particles stacked orderly in the cell wall.

KapI, a non-essential member of the Pse1p/Imp-5 karyopherin family, controls colonial and asexual development in Aspergillus nidulans [SPECIAL ISSUE PAPER]

Thu, 03 Sep 2009 04:01:08 PDT

Asexual development in the filamentous fungus Aspergillus nidulans is governed by the timely expression and cellular localisation of multiple transcription factors. Hence, factors mediating import and export across the nuclear pore complexes (karyopherins) are expected to play a key role in coordinating the developmental programme. Here we characterize KapI, a putative homologue of the Saccharomyces cerevisiae Kap121/Pse1p karyopherin. KapI is a non-essential importin-β-like protein located in the nucleus during vegetative growth and conidiophore development. The kapI phenotype is aconidial with many aerial hyphae. This phenotype can be suppressed under abiotic stress. In this regard, it resembles that of the null allele of the bZIP transcription factor FlbB. However the flbB; kapI, double mutant, exhibited an additive phenotype with totally impaired conidiation, unresponsive to abiotic stress. In contrast to flbB, the null kapI mutant is not a fluffy-low-bristle expression mutant. Taken together the findings indicate that KapI is required during asexual development mediating the nuclear transport of factors acting in a different pathway(s) to those belonging to the Upstream Developmental Activators as FlbB.

SigC sigma factor is involved in acclimation to low inorganic carbon at high temperature in Synechocystis sp. PCC 6803 [CELL AND MOLECULAR BIOLOGY OF MICROBES]

Thu, 03 Sep 2009 04:01:07 PDT

Inactivation of the sigC gene (sll0184) encoding the group 2 sigma factor SigC leads to a heat sensitive phenotype of Synechocystis sp. PCC 6803. Cells of the sigC strain grew poorly at 43 °C at pH 7.5 under ambient CO₂ conditions. Addition of inorganic carbon in the form of 3 % CO₂ or use of an alkaline growth medium (pH 8.3) restored the growth of the sigC strain at 43 °C. These treatments compensate for the low concentration of inorganic carbon at high temperature. However, addition of organic carbon as glucose, pyruvate, succinate or 2-oxoglutarate did not restore growth of the sigC strain at 43 °C. In the control strain, the amount of the SigC factor diminished after prolonged incubation at 43 °C if pH of the growth medium was 7.5 or 6.7. In alkaline conditions, the amount of the SigC factor remained constant at 43 °C and cells of the control strain grew better than at pH 7.5 or pH 6.7. The pH dependence of high temperature growth was associated with changes in photosynthetic activity, indicating that the SigC factor is involved in adjustment of photosynthesis according to the amount of available inorganic carbon. Our results indicate that acclimation to low inorganic carbon is a part of acclimation to prolonged high temperature and the SigC factor has a central role in this acclimation.

FLO11 gene length and transcriptional level affect biofilm forming ability of wild flor strains of Saccharomyces cerevisiae [CELL AND MOLECULAR BIOLOGY OF MICROBES]

Zara, G., Zara, S., Pinna, C., Marceddu, S., Budroni, M. — Thu, 03 Sep 2009 04:01:06 PDT

In Saccharomyces cerevisiae FLO11 codes for an adhesin that is associated with different phenotypes, such as adherence to solid surfaces, hydrophobicity, mat and air-liquid biofilm formation. In the present study, we analysed FLO11 allelic polymorphisms and FLO11-associated phenotypes of 20 flor strains. We identified 13 alleles of different lengths, varying from 3.0 to 6.1 kb, thus demonstrating that FLO11 is highly polymorphic. Two alleles of 3.1 and 5.0 kb were cloned in BY4742 to compare the FLO11-associated phenotypes in the same genetic background. We show that there is a significant correlation between biofilm forming ability and FLO11 length both in different and in the same genetic backgrounds. Moreover, we propose a multiple regression model that allows to predict the air-liquid biofilm forming ability on the basis of the transcription levels and the lengths of FLO11 alleles in a population of S. cerevisiae flor strains. Considering that transcriptional differences are only partially explained by the differences in the promoter sequences, our results are consistent with the hypothesis that FLO11 transcription levels are strongly influenced by genetic background and affect biofilm forming ability.

Variation of the factor H-binding protein of Neisseria meningitidis [MICROBIAL PATHOGENICITY]

Brehony, C., Wilson, D. J, Maiden, M. C.J. — Thu, 03 Sep 2009 04:01:06 PDT

There is currently no comprehensive meningococcal vaccine, due to difficulties in immunising against organisms expressing serogroup B capsules. To address this problem, sub-capsular antigens, particularly the outer membrane proteins (OMPs), are being investigated as candidate vaccine components. If immunogenic, however, such antigens are often antigenically variable and knowledge of the extent and structuring of this diversity is an essential part of vaccine formulation. Factor H-binding protein (fHbp) is one such protein and is included in two vaccines under development. A survey of the diversity of the fHbp gene and the encoded protein in a representative sample of meningococcal isolates confirmed that variability in this protein is structured into two or three major groups, each with a substantial number of alleles that have some association with meningococcal clonal complexes and serogroups. A unified nomenclature scheme was devised to catalogue this diversity. Analysis of recombination and selection on the allele sequences demonstrated that the parts of the gene are subject to positive selection, consistent with immune selection on the protein generating antigenic variation, particularly in the C-terminal region of the peptide sequence. The highest levels of selection were observed in regions corresponding to epitopes recognised by previously described bactericidal monoclonal antibodies.

Trypsin-specific inhibitors from basidiomycete Clitocybe nebularis with regulatory and defensive functions [SPECIAL ISSUE PAPER]

Thu, 20 Aug 2009 05:01:12 PDT

We have isolated serine protease inhibitors from basidiomycete Clitocybe nebularis, CnSPIs, using trypsin affinity chromatography. Full length gene and cDNA sequences were determined for one of them, named cnispin, and the recombinant protein was expressed in Escherichia coli at high yield. The primary structure and biochemical properties of cnispin are very similar to those of the Lentinus edodes serine protease inhibitor, until now, the only member of the I66 family of protease inhibitors in the MEROPS classification. Cnispin is highly specific towards trypsin with Ki in the nanomolar range. It also exhibited weaker inhibition of chymotrypsin and very weak inhibition of subtilisin and kallikrein; other proteases were not inhibited. Inhibitory activity against endogenous proteases from C. nebularis revealed a possible regulatory role in the endogenous proteolytic system for CnSPIs. Another possible biological function in defence against predatory insects was indicated by deleterious effect of CnSPIs on the development of larvae of Drosophila melanogaster. This, together with the characterization, at both the biochemical and genetic levels, of cnispin, a serine protease inhibitor of the I66 MEROPS family, suggests its dual physiological role.

Transcriptional profiling and functional analysis of heterokaryon incompatibility in Neurospora crassa reveals that ROS, but not metacaspases, are associated with programmed cell death [SPECIAL ISSUE PAPER]

Hutchison, E., Brown, S., Tian, C., Glass, N. L. — Thu, 20 Aug 2009 05:01:11 PDT

Heterokaryon incompatibility (HI) is a nonself recognition phenomenon occurring in filamentous fungi that is important for limiting resource plundering and restricting viral transfer between strains. Nonself recognition and HI occurs during hyphal fusion between strains that differ at het loci. If two strains undergo hyphal fusion, but differ in allelic specificity at a het locus, the fusion cell is compartmentalized and undergoes a rapid programmed cell death (PCD). Incompatible heterokaryons show a macroscopic phenotype of slow growth, diminished conidiation and a microscopic phenotype of hyphal compartmentation and cell death. To understand processes associated with HI and PCD, we used whole-genome microarrays for N. crassa to assess transcriptional differences associated with induction of HI mediated by differences in het-c pin-c haplotype. Our data show that HI is a dynamic and transcriptionally active process. The production of reactive oxygen species are implicated in the execution of HI and PCD in N. crassa, as well as several genes involved in phosphatidyl inositol and calcium signaling pathways. However, genes encoding mammalian homologs of caspases or apoptosis-inducing factor (AIF) are not required for HI or programmed cell death. These data indicate that PCD during HI occurs via a novel and possibly fungal-specific mechanism, making this pathway an attractive drug target for control of fungal infections.

Genome-wide analysis of maltose utilization and regulation in aspergilli [SPECIAL ISSUE PAPER]

Vongsangnak, W., Salazar, M., Hansen, K., Nielsen, J. — Thu, 20 Aug 2009 05:01:13 PDT

Maltose utilization and regulation in aspergilli is of great importance for cellular physiology and industrial fermentation processes. In Aspergillus oryzae, maltose utilization requires a functional MAL locus, each composed of three genes: MALR encoding a regulatory protein, MALT encoding maltose permease and MALS encoding maltase. Through a comparative genome and transcriptome analysis we show that the MAL regulon system is active in A. oryzae while it is not present in Aspergillus niger. In order to utilize maltose, A. niger requires a different regulatory system that involves the AmyR regulator for glucoamylase (glaA) induction. Analysis of reporter metabolites and sub-networks illustrate the major route of maltose transport and metabolism in A. oryzae. This demonstrates that overall metabolic responses of A. oryzae occur in terms of genes, enzymes, and metabolites when altering the carbon source. Although the amount of knowledge on maltose transport and metabolism is far from being complete in Aspergillus spp., our study not only helps to understand the sugar preference in industrial fermentation processes, but also indicates how maltose affects gene expression and overall metabolism.

Transcriptional up-regulation of four genes of the lysine biosynthetic pathway by homocitrate accumulation in Penicillium chrysogenum: homocitrate as a sensor system of the pathway distress [SPECIAL ISSUE PAPER]

Thu, 20 Aug 2009 05:01:12 PDT

The lysine biosynthetic pathway has to supply large amounts of -aminoadipic acid for penicillin biosynthesis in Penicillium chrysogenum. In this article, we have characterized the P. chrysogenum L2 mutant, a lysine auxotroph that shows highly increased expression of several lysine biosynthesis genes (lys1, lys2, lys3, lys7). The L2 mutant was found to be deficient in homoaconitase activity since it was complemented by the A. nidulans lysF gene. We have cloned a gene (named lys3) that complements the L2 mutation by transformation with a P. chrysogenum genomic library, constructed in an autonomous replicating plasmid. The lys3 encoded protein showed high identity to homoaconitases. In addition, we cloned the mutant lys3 allele from the L2 strain that showed a G¹⁵³⁴ to A¹⁵³⁴ point mutation resulting in a Gly⁴⁹⁵ to Asp⁴⁹⁵ substitution. This mutation is located in a highly conserved region adjacent to two of the three cysteine residues that act as ligands to bind the iron sulfur cluster required for homoaconitase activity. The L2 mutant accumulates homocitrate. Deletion of the lys1 gene (homocitrate synthase) in the L2 strain prevented homocitrate accumulation and reverted expression levels of the four lysine biosynthesis genes tested to those of the parental prototroph strain. Homocitrate accumulation seems to act as a sensor of the lysine pathway distress triggering overexpression of four of the lysine biosynthesis genes.

Correlation between TCA cycle flux and glucose uptake rate during respiro-fermentative growth of Saccharomyces cerevisiae [PHYSIOLOGY AND BIOCHEMISTRY]

Heyland, J., Fu, J., Blank, L. M. — Fri, 14 Aug 2009 04:01:21 PDT

Glucose repression of the TCA cycle in Saccharomyces cerevisiae was investigated under different environmental conditions by using ¹³C-tracer experiments. Real-time quantification of the volatile metabolites ethanol and CO₂ allowed accurate carbon balancing. In all experiments with the wild-type, a strong correlation between the growth and glucose uptake rates was observed, indicating a constant yield of biomass. In contrast, glycerol and acetate production rates were less dependent on the rate of glucose uptake, but were more affected by environmental conditions. The glycerol production rate (2.9 mmol/g/h) was highest during growth in high osmolarity medium, while the highest acetate production rate of 2.1 mmol/g/h was observed in alkaline medium of pH 6.9. S. cerevisiae had, under standard growth conditions (25 g/L glucose, pH 5.0, 30°C), low fluxes through the pentose phosphate pathway and the TCA cycle. A significant increase in TCA cycle activity from 0.03 mmol/g/h to about 1.7 mmol/g/h was observed when S. cerevisiae grew slower as a result of environmental perturbations, including unfavourable pH values and sodium chloride stress. Compared to experiments with high glucose uptake rates, the ratio of CO₂ to ethanol increased more than 50%, indicating an increase in flux through the TCA cycle. Although glycolysis and the ethanol production pathway still exhibited the highest fluxes, the net flux through the TCA cycle increased significantly with decreasing glucose uptake rates. Results from experiments with single gene deletion mutants partially impaired of glucose repression (hxk2, grr1) indicate that the rate of glucose uptake correlate to this increase in TCA cycle flux. These findings are discussed in the context of regulation of glucose repression.

Methylcitrate cycle activation during adaptation of Fusarium solani and Fusarium verticillioides to propionyl-CoA generating carbon sources [SPECIAL ISSUE PAPER]

Domin, N., Wilson, D., Brock, M. — Thu, 06 Aug 2009 07:01:21 PDT

Propionyl-CoA is an inhibitor of both primary and secondary metabolism in Aspergillus species and a functional methylcitrate cycle is essential for the efficient removal of this potentially toxic metabolite. Although the genomes of most sequenced fungal species appear to contain genes coding for enzymes of the methylcitrate cycle, experimental confirmation of pathway activity in filamentous fungi has only been provided for Aspergillus nidulans and Aspergillus fumigatus. In this study we demonstrate that pathogenic Fusarium species also possess a functional methylcitrate cycle. Fusarium solani appears highly adapted to saprophytic growth as it utilised propionate with high efficiency, whereas Fusarium verticillioides grew poorly on this carbon source. In order to elucidate the mechanisms of propionyl-CoA detoxification, we first identified the genes coding for the methylcitrate synthase from both species. Despite sharing 96% amino acid sequence identity, analysis of the two purified enzymes demonstrated that their biochemical parameters differed in several aspects. Both methylcitrate synthases exhibited low Km values for propionyl-CoA, but that of F. verticillioides displayed significantly higher citrate synthase activity and increased thermal stability. Activity determinations from cell-free extracts of F. solani revealed a strong methylcitrate synthase activity during growth on propionate and to a lesser extent on casamino acids, whereas activity by F. verticillioides was highest on casamino acids. Further phenotypic analysis confirmed that these biochemical differences were reflected in the different growth behaviour of the two species on propionyl-CoA generating carbon sources.

Deletion and overexpression of the Aspergillus nidulans GATA factor AreB reveals unexpected pleiotropy [SPECIAL ISSUE PAPER]

Wong, K. H., Hynes, M. J, Todd, R. B, Davis, M. A — Thu, 23 Jul 2009 04:01:12 PDT

The Aspergillus nidulans transcription factor AreA is a key regulator of nitrogen metabolic gene expression. AreA contains a C-terminal GATA zinc finger DNA-binding domain and activates expression of genes necessary for nitrogen acquisition. Previous studies identified AreB as a potential negative regulator of nitrogen catabolism showing similarity with Penicillium chrysogenum NreB and Neurospora crassa ASD4. The areB gene encodes multiple products containing an N-terminal GATA zinc finger and a leucine zipper motif. We deleted the areB gene and now show that AreB negatively regulates AreA-dependent nitrogen catabolic gene expression under nitrogen limiting or nitrogen starvation conditions. AreB also acts pleiotropically with functions in growth, conidial germination and asexual development, though not in sexual development. AreB overexpression results in severe growth inhibition, aberrant cell morphology and reduced AreA-dependent gene expression. Deletion of either the DNA-binding domain or the leucine zipper domain results in loss of both nitrogen and developmental phenotypes.

Major impacts on the primary metabolism of the plant pathogen Cryphonectria parasitica by the virulence-attenuating virus CHV1-EP713 [PHYSIOLOGY AND BIOCHEMISTRY]

Dawe, A. L., Van Voorhies, W. A., Lau, T. A., Ulanov, A. V., Li, Z. — Thu, 09 Jul 2009 04:01:22 PDT

Cryphonectria parasitica, the chestnut blight fungus, can be infected by virulence-attenuating mycoviruses of the family Hypoviridae. Previous studies have led to the hypothesis that the hypovirus-infected phenotype is partly due to metabolic changes induced by the viral infection. To investigate this, we have measured the metabolic rate and respiration of C. parasitica colonies grown on solid medium. These experiments supported historical observations of other fungal species done in liquid cultures that the metabolic rate steadily declines with age and differentiation of the mycelium. Hypovirus infection increased metabolic rate in the youngest mycelium, but a subsequent decline was also observed as the mycelium aged. By measuring both CO2 production and O2 consumption, we have also observed that changes occur in carbohydrate metabolism as a result of aging in both infected and uninfected mycelium. Mycelium on the periphery of the colony exploited fermentation pathways extensively, before transitioning to aerobic carbohydrate metabolism and finally lipid metabolism in the interior regions, despite abundant remaining glucose. However, the hypovirus affected the extent of these changes, with infected mycelium apparently unable to utilize lipid-related metabolic pathways leading to an increased depletion of glucose. Finally, we used metabolic profiling to determine the changes in accumulation of primary metabolites in wild-type and hypovirus-infected mycelium and found that approximately one third of the 164 detected metabolites were affected. These results are consistent with that expected from the physiological measurements, with significant alterations noted for compounds related to lipid and carbohydrate metabolism. Additionally, we observed an increase in the accumulation of the polyamine spermidine in the presence of hypovirus. Polyamines have been implicated in antiviral responses of mammalian systems, therefore this may suggest a novel antiviral response mechanism in fungi.